LOCUS       NM_033095                634 bp    mRNA    linear   ROD 15-JUL-2023
DEFINITION  Rattus norvegicus crystallin, gamma D (Crygd), mRNA.
ACCESSION   NM_033095
VERSION     NM_033095.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 634)
  AUTHORS   Johnson AC, Lee JW, Harmon AC, Morris Z, Wang X, Fratkin J, Rapp
            JP, Gomez-Sanchez E and Garrett MR.
  TITLE     A mutation in the start codon of gamma-crystallin D leads to
            nuclear cataracts in the Dahl SS/Jr-Ctr strain
  JOURNAL   Mamm Genome 24 (3-4), 95-104 (2013)
   PUBMED   23404175
  REMARK    GeneRIF: The Met1Val substitution in CrygD is almost certainly the
            cause of cataracts in the SS/Jr-Ctr rat strain.
REFERENCE   2  (bases 1 to 634)
  AUTHORS   Wang K, Cheng C, Li L, Liu H, Huang Q, Xia CH, Yao K, Sun P,
            Horwitz J and Gong X.
  TITLE     GammaD-crystallin associated protein aggregation and lens fiber
            cell denucleation
  JOURNAL   Invest Ophthalmol Vis Sci 48 (8), 3719-3728 (2007)
   PUBMED   17652744
REFERENCE   3  (bases 1 to 634)
  AUTHORS   Graw J, Neuhauser-Klaus A, Klopp N, Selby PB, Loster J and Favor J.
  TITLE     Genetic and allelic heterogeneity of Cryg mutations in eight
            distinct forms of dominant cataract in the mouse
  JOURNAL   Invest Ophthalmol Vis Sci 45 (4), 1202-1213 (2004)
   PUBMED   15037589
REFERENCE   4  (bases 1 to 634)
  AUTHORS   Nandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Benazzouz B,
            Hajaji Y, Boutayeb S, Gribouval O, Arbogast L, Berraho A, Abitbol M
            and Hilal L.
  TITLE     Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant
            congenital cerulean cataracts
  JOURNAL   J Med Genet 40 (4), 262-267 (2003)
   PUBMED   12676897
REFERENCE   5  (bases 1 to 634)
  AUTHORS   Santhiya,S.T., Shyam Manohar,M., Rawlley,D., Vijayalakshmi,P.,
            Namperumalsamy,P., Gopinath,P.M., Loster,J. and Graw,J.
  TITLE     Novel mutations in the gamma-crystallin genes cause autosomal
            dominant congenital cataracts
  JOURNAL   J Med Genet 39 (5), 352-358 (2002)
   PUBMED   12011157
REFERENCE   6  (bases 1 to 634)
  AUTHORS   Dirks RP, Klok EJ, van Genesen ST, Schoenmakers JG and Lubsen NH.
  TITLE     The sequence of regulatory events controlling the expression of the
            gamma D-crystallin gene during fibroblast growth factor-mediated
            rat lens fiber cell differentiation
  JOURNAL   Dev Biol 173 (1), 14-25 (1996)
   PUBMED   8575616
REFERENCE   7  (bases 1 to 634)
  AUTHORS   Ooki K, Amuro N, Shimizu Y and Okazaki T.
  TITLE     High level expression of rat gamma-D-crystallin in Escherichia coli
  JOURNAL   Biochimie 76 (5), 398-403 (1994)
   PUBMED   7849105
REFERENCE   8  (bases 1 to 634)
  AUTHORS   Voorter CE, De Haard-Hoekman WA, Hermans MM, Bloemendal H and De
            Jong WW.
  TITLE     Differential synthesis of crystallins in the developing rat eye
            lens
  JOURNAL   Exp Eye Res 50 (4), 429-437 (1990)
   PUBMED   2338125
REFERENCE   9  (bases 1 to 634)
  AUTHORS   den Dunnen JT, van Neck JW, Cremers FP, Lubsen NH and Schoenmakers
            JG.
  TITLE     Nucleotide sequence of the rat gamma-crystallin gene region and
            comparison with an orthologous human region
  JOURNAL   Gene 78 (2), 201-213 (1989)
   PUBMED   2777080
REFERENCE   10 (bases 1 to 634)
  AUTHORS   den Dunnen,J.T., Moormann,R.J., Lubsen,N.H. and Schoenmakers,J.G.
  TITLE     Concerted and divergent evolution within the rat gamma-crystallin
            gene family
  JOURNAL   J Mol Biol 189 (1), 37-46 (1986)
   PUBMED   3783678
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000214.1.
            
            On Oct 31, 2022 this sequence version replaced NM_033095.1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: X57169.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06680412, SAMN06680413
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-51                JACYVU010000214.1  22438509-22438559   c
            52-294              JACYVU010000214.1  22438179-22438421   c
            295-634             JACYVU010000214.1  22436948-22437287   c
FEATURES             Location/Qualifiers
     source          1..634
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="9"
                     /map="9q32"
     gene            1..634
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /note="crystallin, gamma D"
                     /db_xref="GeneID:24278"
                     /db_xref="RGD:2422"
     exon            1..51
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    10..12
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /note="upstream in-frame stop codon"
     CDS             43..567
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /note="gamma-D-crystallin; gamma-crystallin 2-2;
                     Crystallin, gamma polypeptide 4"
                     /codon_start=1
                     /product="gamma-crystallin D"
                     /protein_id="NP_149086.1"
                     /db_xref="GeneID:24278"
                     /db_xref="RGD:2422"
                     /translation="

MGKITFYEDRGFQGRHYECSTDHSNLQPYFSRCNSVRVDSGCWMLYEQPNFTGCQYFLRRGDYPDYQQWMGFSDSVRSCRLIPHAGSHRIRLYEREDYRGQMVEFTEDCPSLQDRFHFNEIYSLNVLEGCWVLYEMTNYRGRQYLLRPGEYRRYHDWGAMNARVGSLRRVMDFY"

     misc_feature    49..288
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /note="Beta/gamma crystallins; Region: XTALbg; smart00247"
                     /db_xref="CDD:214583"
     misc_feature    292..303
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /note="propagated from UniProtKB/Swiss-Prot (P10067.2);
                     Region: Connecting peptide"
     misc_feature    307..552
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /note="Beta/Gamma crystallin; Region: Crystall; pfam00030"
                     /db_xref="CDD:425430"
     exon            52..294
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /inference="alignment:Splign:2.1.0"
     exon            295..634
                     /gene="Crygd"
                     /gene_synonym="Cryg4; Len"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

acactcaactgaaacctcccatccgacccgcaaacaacagccatggggaagatcaccttctatgaggaccgcggcttccagggccgccactatgagtgcagcacagaccactccaacctgcagccctacttcagccgctgcaactctgtgcgcgtggacagtggctgctggatgctctatgagcagcccaacttcacaggctgccagtacttccttcgtcgcggggactaccctgactaccagcagtggatgggtttcagcgactctgtccgctcctgccgcctcatcccccacgccggctcccacaggatcagactgtacgagagggaagattacagaggccagatggtagagttcactgaggactgcccctctctccaggaccgattccacttcaatgagatctactccctcaatgtgctggagggctgctgggtcctctatgagatgaccaactacagggggcgacagtacctgctgaggcccggggagtataggcgctaccacgactggggcgccatgaatgccagggttggctctctgaggagagtcatggatttctattaaattggttttttactctaccctttctccatctggaagctaataaagtattttctgtgtgttcccggca

//