2024-05-05 12:44:46, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_033095 634 bp mRNA linear ROD 15-JUL-2023 DEFINITION Rattus norvegicus crystallin, gamma D (Crygd), mRNA. ACCESSION NM_033095 VERSION NM_033095.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 634) AUTHORS Johnson AC, Lee JW, Harmon AC, Morris Z, Wang X, Fratkin J, Rapp JP, Gomez-Sanchez E and Garrett MR. TITLE A mutation in the start codon of gamma-crystallin D leads to nuclear cataracts in the Dahl SS/Jr-Ctr strain JOURNAL Mamm Genome 24 (3-4), 95-104 (2013) PUBMED 23404175 REMARK GeneRIF: The Met1Val substitution in CrygD is almost certainly the cause of cataracts in the SS/Jr-Ctr rat strain. REFERENCE 2 (bases 1 to 634) AUTHORS Wang K, Cheng C, Li L, Liu H, Huang Q, Xia CH, Yao K, Sun P, Horwitz J and Gong X. TITLE GammaD-crystallin associated protein aggregation and lens fiber cell denucleation JOURNAL Invest Ophthalmol Vis Sci 48 (8), 3719-3728 (2007) PUBMED 17652744 REFERENCE 3 (bases 1 to 634) AUTHORS Graw J, Neuhauser-Klaus A, Klopp N, Selby PB, Loster J and Favor J. TITLE Genetic and allelic heterogeneity of Cryg mutations in eight distinct forms of dominant cataract in the mouse JOURNAL Invest Ophthalmol Vis Sci 45 (4), 1202-1213 (2004) PUBMED 15037589 REFERENCE 4 (bases 1 to 634) AUTHORS Nandrot E, Slingsby C, Basak A, Cherif-Chefchaouni M, Benazzouz B, Hajaji Y, Boutayeb S, Gribouval O, Arbogast L, Berraho A, Abitbol M and Hilal L. TITLE Gamma-D crystallin gene (CRYGD) mutation causes autosomal dominant congenital cerulean cataracts JOURNAL J Med Genet 40 (4), 262-267 (2003) PUBMED 12676897 REFERENCE 5 (bases 1 to 634) AUTHORS Santhiya,S.T., Shyam Manohar,M., Rawlley,D., Vijayalakshmi,P., Namperumalsamy,P., Gopinath,P.M., Loster,J. and Graw,J. TITLE Novel mutations in the gamma-crystallin genes cause autosomal dominant congenital cataracts JOURNAL J Med Genet 39 (5), 352-358 (2002) PUBMED 12011157 REFERENCE 6 (bases 1 to 634) AUTHORS Dirks RP, Klok EJ, van Genesen ST, Schoenmakers JG and Lubsen NH. TITLE The sequence of regulatory events controlling the expression of the gamma D-crystallin gene during fibroblast growth factor-mediated rat lens fiber cell differentiation JOURNAL Dev Biol 173 (1), 14-25 (1996) PUBMED 8575616 REFERENCE 7 (bases 1 to 634) AUTHORS Ooki K, Amuro N, Shimizu Y and Okazaki T. TITLE High level expression of rat gamma-D-crystallin in Escherichia coli JOURNAL Biochimie 76 (5), 398-403 (1994) PUBMED 7849105 REFERENCE 8 (bases 1 to 634) AUTHORS Voorter CE, De Haard-Hoekman WA, Hermans MM, Bloemendal H and De Jong WW. TITLE Differential synthesis of crystallins in the developing rat eye lens JOURNAL Exp Eye Res 50 (4), 429-437 (1990) PUBMED 2338125 REFERENCE 9 (bases 1 to 634) AUTHORS den Dunnen JT, van Neck JW, Cremers FP, Lubsen NH and Schoenmakers JG. TITLE Nucleotide sequence of the rat gamma-crystallin gene region and comparison with an orthologous human region JOURNAL Gene 78 (2), 201-213 (1989) PUBMED 2777080 REFERENCE 10 (bases 1 to 634) AUTHORS den Dunnen,J.T., Moormann,R.J., Lubsen,N.H. and Schoenmakers,J.G. TITLE Concerted and divergent evolution within the rat gamma-crystallin gene family JOURNAL J Mol Biol 189 (1), 37-46 (1986) PUBMED 3783678 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000214.1. On Oct 31, 2022 this sequence version replaced NM_033095.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: X57169.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN06680412, SAMN06680413 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-51 JACYVU010000214.1 22438509-22438559 c 52-294 JACYVU010000214.1 22438179-22438421 c 295-634 JACYVU010000214.1 22436948-22437287 c FEATURES Location/Qualifiers source 1..634 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="9" /map="9q32" gene 1..634 /gene="Crygd" /gene_synonym="Cryg4; Len" /note="crystallin, gamma D" /db_xref="GeneID:24278" /db_xref="RGD:2422" exon 1..51 /gene="Crygd" /gene_synonym="Cryg4; Len" /inference="alignment:Splign:2.1.0" misc_feature 10..12 /gene="Crygd" /gene_synonym="Cryg4; Len" /note="upstream in-frame stop codon" CDS 43..567 /gene="Crygd" /gene_synonym="Cryg4; Len" /note="gamma-D-crystallin; gamma-crystallin 2-2; Crystallin, gamma polypeptide 4" /codon_start=1 /product="gamma-crystallin D" /protein_id="NP_149086.1" /db_xref="GeneID:24278" /db_xref="RGD:2422" /translation="
MGKITFYEDRGFQGRHYECSTDHSNLQPYFSRCNSVRVDSGCWMLYEQPNFTGCQYFLRRGDYPDYQQWMGFSDSVRSCRLIPHAGSHRIRLYEREDYRGQMVEFTEDCPSLQDRFHFNEIYSLNVLEGCWVLYEMTNYRGRQYLLRPGEYRRYHDWGAMNARVGSLRRVMDFY"
misc_feature 49..288 /gene="Crygd" /gene_synonym="Cryg4; Len" /note="Beta/gamma crystallins; Region: XTALbg; smart00247" /db_xref="CDD:214583" misc_feature 292..303 /gene="Crygd" /gene_synonym="Cryg4; Len" /note="propagated from UniProtKB/Swiss-Prot (P10067.2); Region: Connecting peptide" misc_feature 307..552 /gene="Crygd" /gene_synonym="Cryg4; Len" /note="Beta/Gamma crystallin; Region: Crystall; pfam00030" /db_xref="CDD:425430" exon 52..294 /gene="Crygd" /gene_synonym="Cryg4; Len" /inference="alignment:Splign:2.1.0" exon 295..634 /gene="Crygd" /gene_synonym="Cryg4; Len" /inference="alignment:Splign:2.1.0" ORIGIN
acactcaactgaaacctcccatccgacccgcaaacaacagccatggggaagatcaccttctatgaggaccgcggcttccagggccgccactatgagtgcagcacagaccactccaacctgcagccctacttcagccgctgcaactctgtgcgcgtggacagtggctgctggatgctctatgagcagcccaacttcacaggctgccagtacttccttcgtcgcggggactaccctgactaccagcagtggatgggtttcagcgactctgtccgctcctgccgcctcatcccccacgccggctcccacaggatcagactgtacgagagggaagattacagaggccagatggtagagttcactgaggactgcccctctctccaggaccgattccacttcaatgagatctactccctcaatgtgctggagggctgctgggtcctctatgagatgaccaactacagggggcgacagtacctgctgaggcccggggagtataggcgctaccacgactggggcgccatgaatgccagggttggctctctgaggagagtcatggatttctattaaattggttttttactctaccctttctccatctggaagctaataaagtattttctgtgtgttcccggca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]