LOCUS       NM_031555               2132 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus beaded filament structural protein 1 (Bfsp1),
            mRNA.
ACCESSION   NM_031555 XM_001053697 XM_342529
VERSION     NM_031555.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2132)
  AUTHORS   Oka M, Kudo H, Sugama N, Asami Y and Takehana M.
  TITLE     The function of filensin and phakinin in lens transparency
  JOURNAL   Mol Vis 14, 815-822 (2008)
   PUBMED   18449355
  REMARK    GeneRIF: The degradation of filensin and phakinin in normal and
            cataractous rat lenses, was examined.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2132)
  AUTHORS   Wyatt K, Gao C, Tsai JY, Fariss RN, Ray S and Wistow G.
  TITLE     A role for lengsin, a recruited enzyme, in terminal differentiation
            in the vertebrate lens
  JOURNAL   J Biol Chem 283 (10), 6607-6615 (2008)
   PUBMED   18178558
REFERENCE   3  (bases 1 to 2132)
  AUTHORS   Yoon KH, Blankenship T, Shibata B and Fitzgerald PG.
  TITLE     Resisting the effects of aging: a function for the fiber cell
            beaded filament
  JOURNAL   Invest Ophthalmol Vis Sci 49 (3), 1030-1036 (2008)
   PUBMED   18326727
REFERENCE   4  (bases 1 to 2132)
  AUTHORS   Sandilands A, Wang X, Hutcheson AM, James J, Prescott AR, Wegener
            A, Pekny M, Gong X and Quinlan RA.
  TITLE     Bfsp2 mutation found in mouse 129 strains causes the loss of CP49'
            and induces vimentin-dependent changes in the lens fibre cell
            cytoskeleton
  JOURNAL   Exp Eye Res 78 (4), 875-889 (2004)
   PUBMED   15037121
REFERENCE   5  (bases 1 to 2132)
  AUTHORS   DePianto DJ, Blankenship TN, Hess JF and FitzGerald PG.
  TITLE     Analysis of non-crystallin lens fiber cell gene expression in c-Maf
            -/- mice
  JOURNAL   Mol Vis 9, 288-294 (2003)
   PUBMED   12835653
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2132)
  AUTHORS   Masaki S and Watanabe T.
  TITLE     cDNA sequence analysis of CP94: rat lens fiber cell beaded-filament
            structural protein shows homology to cytokeratins
  JOURNAL   Biochem Biophys Res Commun 186 (1), 190-198 (1992)
   PUBMED   1378722
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AB003104.1.
            
            On or before Oct 13, 2007 this sequence version replaced
            XM_001053697.1, XM_342529.2.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AB003104.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2132              AB003104.1         2-2133
FEATURES             Location/Qualifiers
     source          1..2132
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3q41"
     gene            1..2132
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="beaded filament structural protein 1"
                     /db_xref="GeneID:25394"
                     /db_xref="RGD:2205"
     exon            1..368
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     CDS             13..2007
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="lens fiber cell beaded-filament structural protein
                     CP 94; CP97 115-kDa; beaded filament structural protein 1,
                     filensin"
                     /codon_start=1
                     /product="filensin"
                     /protein_id="NP_113743.1"
                     /db_xref="GeneID:25394"
                     /db_xref="RGD:2205"
                     /translation="

MYRRSYVFQARQERYERAQPAGPTAQPGGTAPGLAALQALGERVAAQVQRARALQQRHAGLRRQLYAFQRLGEQPGPEEALARHVEANLQRARDLAAEHARLERQEAEAQRALDEFRSKYENECECQLVLKEMLERLNKEADEALLRNLHLQLEAQFLQADISVAKDRYKKNLLEIQTYITILQQIIQTAPQVSLVTGGMREEKLLTEREVAALRNQLDEGREAVTHLQAQKAELQAQTTALEQAIKHAHECYDDEIQLYNGQIENLRKEIEEAERSLERSSYDCRQLAVAQQTLRNELDRYHRIIEIEGNRLSSVFIETPISLITPSHGASLSLGSNVKDLTRAVQDITAAKPRQKALPKSLPKRKEIIAQDKVDETLEDAPLKTLQEPKAVQGELTGDGDSQLGAGGGHEVSPTQEGGPEDVPDGSQISKAFGKLCKVVKERVSGHKEPVPEPPADLFTKGRHILVTGESSFVDPEFYSSSIPARGGVVVSIEEDSMHHDGHVEPSPGQPMPPVENGQGVPQGREGAHSNHQQVTDKNGIRAKEPKDLEEKDDDSRKDDEAGRRPCPVIIPGPDGPSTTHSQTSGSNQGGPEGPGSKSSSLLAKSPSKALSFKKVEVVESIEKISTESIQTYEETSVIVETVIGKTKGNKKPGEKSSSNAKA"

     misc_feature    13..111
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Head"
     misc_feature    25..27
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); phosphorylation site"
     misc_feature    112..216
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Coil 1A"
     misc_feature    112..117
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Cleavage. /evidence=ECO:0000250|UniProtKB:Q06002;
                     propagated from UniProtKB/Swiss-Prot (Q02435.2); cleavage
                     site"
     misc_feature    115..117
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="N-acetylalanine.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); acetylation site"
     misc_feature    118..948
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
     misc_feature    217..243
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Linker 1"
     misc_feature    244..543
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Coil 1B"
     misc_feature    544..594
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Linker 12"
     misc_feature    595..951
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Coil 2"
     misc_feature    1012..1014
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); phosphorylation site"
     misc_feature    1153..1299
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1288..1293
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Cleavage (by CASP2, CASP3, and CASP7).
                     /evidence=ECO:0000250|UniProtKB:Q12934; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); cleavage site"
     misc_feature    1360..1362
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Interaction with MIP.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); other site"
     misc_feature    1507..1863
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="propagated from UniProtKB/Swiss-Prot (Q02435.2);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1534..1536
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); phosphorylation site"
     misc_feature    1750..1752
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); phosphorylation site"
     misc_feature    1831..1833
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q06002; propagated from
                     UniProtKB/Swiss-Prot (Q02435.2); phosphorylation site"
     exon            369..429
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     exon            430..525
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     exon            526..618
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     exon            619..726
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     exon            727..947
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     exon            948..1033
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
     exon            1034..2132
                     /gene="Bfsp1"
                     /gene_synonym="115-kDa; CP94; CP95; CP97"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

cttccgggagccatgtaccgccgcagctacgtcttccaggcccgccaggagcgctacgagcgcgcccagcccgcgggccctaccgcccaacccggaggaaccgcgcccggcctggcggcgctgcaggcactgggcgagcgcgtggccgcccaggtccagcgggcccgcgcgctccagcagcgccacgccggcctgaggcggcagctctacgccttccagcgcctgggcgagcagcccgggcccgaggaggcgcttgcccgccacgtcgaggccaatctgcagcgcgcccgggacctggcagccgagcacgcgcggctggagaggcaggaggccgaggcgcagcgcgcgctcgacgagttccgcagcaaatacgaaaatgagtgtgaatgtcaattggtgctaaaggaaatgctggaacggctgaacaaggaagctgatgaagccttattgcgtaacctgcaccttcagttggaagcccagtttctgcaggcagatatcagtgtggccaaggacaggtacaaaaagaatcttctggaaattcagacctacatcaccatcctgcagcagatcatacagactgctcctcaagtgtccctggtcacgggtgggatgagggaggagaagctgctcacagaacgggaagtagctgccctgaggaaccagctggatgagggccgggaggcagtcacccacctgcaggcacagaaagctgagctgcaggcccagacaacagccctggaacaagctattaagcatgctcatgagtgctacgatgacgagatccagctttataatgggcagatcgaaaacctccggaaggagatagaggaggctgagcggtctctggagaggtcgtcctatgactgcaggcagctggctgtggcccagcagaccctgaggaacgagctagaccggtatcatcggatcattgagattgaaggcaacaggttgagctccgttttcatagagactcccatctctttgatcaccccaagccatggggcctctctcagccttggatccaatgtgaaagatcttaccagggctgtgcaggatattacagcagctaaacccagacagaaggccctccccaagagccttccaaaaagaaaggagattatagctcaagataaagtggacgaaactctggaagatgcaccattaaaaactctacaagagccaaaggcagtgcagggggagcttacaggagatggagactctcagctgggagcagggggcggacatgaagtaagtccaacacaagaaggcggtcctgaggacgtgccagatgggagccagataagcaaagcctttgggaaactttgcaaagtagtcaaagagagagtgagcggccacaaagagcctgtgccagagccacccgcggacctcttcaccaaaggacggcatatactggtcacaggggaatctagttttgttgaccccgagttctactcctcctccatcccagctagaggtggggtggtggtttccattgaggaagactctatgcatcatgatggccatgtggagccctctcctggacagcccatgccacctgtggagaatggtcagggggttccccagggcagggaaggtgcccactcaaaccatcaacaggttacagacaagaatgggataagagccaaggaaccgaaagatctggaggaaaaagatgatgacagcaggaaggacgatgaggcgggcaggagaccctgtcctgtgatcatacctggtcctgatggaccatctacgacccattcacaaacgtctgggtccaatcagggtggaccagaggggcctgggagtaagagcagtagcctgctggccaagagcccttcgaaggctttgtcttttaagaaggtagaggtggtggaatccattgagaagatttcgacagagagtattcagacgtatgaagaaacttctgtaattgtggagacggtgattgggaagacaaagggtaacaagaaaccgggagagaagagctcctcaaatgccaaggcttgaaggaagagagtgtctggggccagtaggggaagtgctttgagatagcttcctgtttggattagatcatagttgacctgtctggcggacgaccttcattaaactgctttatttttgcttgcaccatc

//