LOCUS       NM_019201               2420 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus C-terminal binding protein 1 (Ctbp1), mRNA.
ACCESSION   NM_019201 XM_001062979 XM_001063046 XM_001063097
VERSION     NM_019201.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2420)
  AUTHORS   Ivanova D, Imig C, Camacho M, Reinhold A, Guhathakurta D,
            Montenegro-Venegas C, Cousin MA, Gundelfinger ED, Rosenmund C,
            Cooper B and Fejtova A.
  TITLE     CtBP1-Mediated Membrane Fission Contributes to Effective Recycling
            of Synaptic Vesicles
  JOURNAL   Cell Rep 30 (7), 2444-2459 (2020)
   PUBMED   32075774
REFERENCE   2  (bases 1 to 2420)
  AUTHORS   Fragoza R, Das J, Wierbowski SD, Liang J, Tran TN, Liang S, Beltran
            JF, Rivera-Erick CA, Ye K, Wang TY, Yao L, Mort M, Stenson PD,
            Cooper DN, Wei X, Keinan A, Schimenti JC, Clark AG and Yu H.
  TITLE     Extensive disruption of protein interactions by genetic variants
            across the allele frequency spectrum in human populations
  JOURNAL   Nat Commun 10 (1), 4141 (2019)
   PUBMED   31515488
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2420)
  AUTHORS   Hu K, Li Y, Yu H and Hu Y.
  TITLE     CTBP1 Confers Protection for Hippocampal and Cortical Neurons in
            Rat Models of Alzheimer's Disease
  JOURNAL   Neuroimmunomodulation 26 (3), 139-152 (2019)
   PUBMED   31340205
  REMARK    GeneRIF: CTBP1 Confers Protection for Hippocampal and Cortical
            Neurons in Rat Models of Alzheimer's Disease.
REFERENCE   4  (bases 1 to 2420)
  AUTHORS   Rocca DL, Wilkinson KA and Henley JM.
  TITLE     SUMOylation of FOXP1 regulates transcriptional repression via CtBP1
            to drive dendritic morphogenesis
  JOURNAL   Sci Rep 7 (1), 877 (2017)
   PUBMED   28408745
  REMARK    GeneRIF: Results shed light on the binding of CtBP1 protein to
            SUMOylated Foxp1 to repress the genetic transcription and drive
            dendritic morphogenesis.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 2420)
  AUTHORS   Yachie N, Petsalaki E, Mellor JC, Weile J, Jacob Y, Verby M, Ozturk
            SB, Li S, Cote AG, Mosca R, Knapp JJ, Ko M, Yu A, Gebbia M, Sahni
            N, Yi S, Tyagi T, Sheykhkarimli D, Roth JF, Wong C, Musa L, Snider
            J, Liu YC, Yu H, Braun P, Stagljar I, Hao T, Calderwood MA,
            Pelletier L, Aloy P, Hill DE, Vidal M and Roth FP.
  TITLE     Pooled-matrix protein interaction screens using Barcode Fusion
            Genetics
  JOURNAL   Mol Syst Biol 12 (4), 863 (2016)
   PUBMED   27107012
  REMARK    Publication Status: Online-Only
REFERENCE   6  (bases 1 to 2420)
  AUTHORS   Chinnadurai G.
  TITLE     CtBP, an unconventional transcriptional corepressor in development
            and oncogenesis
  JOURNAL   Mol Cell 9 (2), 213-224 (2002)
   PUBMED   11864595
  REMARK    GeneRIF: CtBp proteins repress transcription in a histone
            deacetylase dependent or independent manner.
            Review article
REFERENCE   7  (bases 1 to 2420)
  AUTHORS   Riefler GM and Firestein BL.
  TITLE     Binding of neuronal nitric-oxide synthase (nNOS) to
            carboxyl-terminal-binding protein (CtBP) changes the localization
            of CtBP from the nucleus to the cytosol: a novel function for
            targeting by the PDZ domain of nNOS
  JOURNAL   J Biol Chem 276 (51), 48262-48268 (2001)
   PUBMED   11590170
REFERENCE   8  (bases 1 to 2420)
  AUTHORS   Spano S, Silletta MG, Colanzi A, Alberti S, Fiucci G, Valente C,
            Fusella A, Salmona M, Mironov A, Luini A and Corda D.
  TITLE     Molecular cloning and functional characterization of brefeldin
            A-ADP-ribosylated substrate. A novel protein involved in the
            maintenance of the Golgi structure
  JOURNAL   J Biol Chem 274 (25), 17705-17710 (1999)
   PUBMED   10364211
  REMARK    Erratum:[J Biol Chem 1999 Aug 27;274(35):25188. Spanfo S [corrected
            to Spano S]]
REFERENCE   9  (bases 1 to 2420)
  AUTHORS   Di Girolamo M, Silletta MG, De Matteis MA, Braca A, Colanzi A,
            Pawlak D, Rasenick MM, Luini A and Corda D.
  TITLE     Evidence that the 50-kDa substrate of brefeldin A-dependent
            ADP-ribosylation binds GTP and is modulated by the G-protein beta
            gamma subunit complex
  JOURNAL   Proc Natl Acad Sci U S A 92 (15), 7065-7069 (1995)
   PUBMED   7624370
REFERENCE   10 (bases 1 to 2420)
  AUTHORS   Belgrader P, Dey R and Berezney R.
  TITLE     Molecular cloning of matrin 3. A 125-kilodalton protein of the
            nuclear matrix contains an extensive acidic domain
  JOURNAL   J Biol Chem 266 (15), 9893-9899 (1991)
   PUBMED   2033075
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF067795.2.
            
            On Feb 21, 2013 this sequence version replaced NM_019201.2.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF067795.2 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2420              AF067795.2         6-2425
FEATURES             Location/Qualifiers
     source          1..2420
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="Sprague-Dawley"
                     /db_xref="taxon:10116"
                     /chromosome="14"
                     /map="14q21"
     gene            1..2420
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="C-terminal binding protein 1"
                     /db_xref="GeneID:29382"
                     /db_xref="RGD:2441"
     exon            1..196
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            197..389
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    377..379
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="upstream in-frame stop codon"
     CDS             383..1675
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="C-terminus binding protein 3/brefeldin A (BFA)
                     adenosine diphosphate-ribosylated substrate; ctBP3;
                     C-terminal-binding protein 3; 50 kDa BFA-dependent
                     ADP-ribosylation substrate; brefeldin A-ADP-riboslyated
                     substrate; 50-kDa BFA-induced ADP-ribosylated substrate"
                     /codon_start=1
                     /product="C-terminal-binding protein 1"
                     /protein_id="NP_062074.2"
                     /db_xref="GeneID:29382"
                     /db_xref="RGD:2441"
                     /translation="

MSGVRPPIMNGPMHPRPLVALLDGRDCTVEMPILKDVATVAFCDAQSTQEIHEKVLNEAVGALMYHTITLTREDLEKFKALRIIVRIGSGFDNIDIKSAGDLGIAVCNVPAASVEETADSTLCHILNLYRRTTWLHQALREGTRVQSVEQIREVASGAARIRGETLGIIGLGRVGQAVALRAKAFGFNVLFYDPYLSDGIERALGLQRVSTLQDLLFHSDCVTLHCGLNEHNHHLINDFTVKQMRQGAFLVNTARGGLVDEKALAQALKEGRIRGAALDVHESEPFSFSQGPLKDAPNLICTPHAAWYSEQASIEMREEAAREIRRAITGRIPDSLKNCVNKDHLTAATHWASMDPAVVHPELNGAAYSRYPPGVVSVAPTGIPAAVEGIVPSAMSLSHGLPPVAHPPHAPSPGQTVKPEADRDHTTDQL"

     misc_feature    383..559
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3);
                     Region: Interaction with GLIS2 1. /evidence=ECO:0000250"
     misc_feature    431..1387
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="C-terminal binding protein (CtBP),
                     D-isomer-specific 2-hydroxyacid dehydrogenases related
                     repressor; Region: CtBP_dh; cd05299"
                     /db_xref="CDD:240624"
     misc_feature    order(638..640,647..652,1145..1147,1292..1294,1301..1303)
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="ligand binding site [chemical binding]; other site"
                     /db_xref="CDD:240624"
     misc_feature    order(647..649,731..733,887..892,896..904,956..970,
                     1055..1063,1067..1069,1076..1078,1139..1147,1217..1222,
                     1292..1294,1298..1303)
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="NAD binding site [chemical binding]; other site"
                     /db_xref="CDD:240624"
     misc_feature    1211..1429
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3);
                     Region: Interaction with GLIS2 2. /evidence=ECO:0000250"
     misc_feature    1247..1249
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13363; propagated from
                     UniProtKB/Swiss-Prot (Q9Z2F5.3); phosphorylation site"
     misc_feature    1472..1477
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="Cleavage, by CAPN1.
                     /evidence=ECO:0000250|UniProtKB:Q13363; propagated from
                     UniProtKB/Swiss-Prot (Q9Z2F5.3); cleavage site"
     misc_feature    1511..1516
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="Cleavage, by CAPN1.
                     /evidence=ECO:0000250|UniProtKB:Q13363; propagated from
                     UniProtKB/Swiss-Prot (Q9Z2F5.3); cleavage site"
     misc_feature    1574..1672
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1577..1582
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="Cleavage, by CAPN1 and CAPN3.
                     /evidence=ECO:0000250|UniProtKB:Q13363; propagated from
                     UniProtKB/Swiss-Prot (Q9Z2F5.3); cleavage site"
     misc_feature    1616..1618
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q13363; propagated from
                     UniProtKB/Swiss-Prot (Q9Z2F5.3); phosphorylation site"
     exon            390..544
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            545..689
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            690..896
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            897..1111
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            1112..1242
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            1243..1370
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            1371..1488
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
     exon            1489..2420
                     /gene="Ctbp1"
                     /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate;
                     Bars; BARS-50; CtBP3/BARS"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gcgcggctggcggcgcggtggcggctcggcacggcggtggccggtcgcaggcggccgggcggaatagcagactgcgccgaagccgccccaggcgcagggctcgcggcggcggagagcgccggactcatcggggcccgcggccacccgcgcctttcaatgggcagctcgcacttgctcaacaagggcctgccgctggtaagactttgaacccgacgcaggcttcagtggctgctgtggagcagaagcctgagagctttggttggagacaataagacgtgggatgaggctccgtgacagaacgcggttcggcctggggattctgaagacaaaaagctttggacaggcgaattcatggtcgtggaaaccccgccccaattaagcaatgtcaggcgtccgacctcccatcatgaacgggcccatgcacccccggcccctggtggcgctgctggatggccgggactgcacagtggagatgcctatcctgaaggatgtggccacagtagccttctgtgatgcgcagtccacacaggagatccatgagaaggtactgaatgaggcagtgggcgccctgatgtaccataccatcacactgaccagagaagatctggagaagtttaaagctctcagaatcatcgtccgaattggcagcgggtttgacaacatagacatcaagtcagctggtgatctaggcatcgcagtgtgcaatgtaccagcagcatctgtggaagaaacagcagactccaccctgtgccacattctgaacctataccgacgaactacctggctacaccaggcacttcgggaaggcactcgggtccagagtgtagagcagatccgagaggtggcttcaggagctgccaggatccgtggagagaccttgggcatcattggactaggtcgtgtgggccaggcggtggcacttcgggcaaaggcttttggcttcaacgtcctcttctatgacccatacctatctgatggaatcgagcgggccctggggctgcagcgtgtgagcacactgcaggacctgctcttccacagtgactgcgttaccctgcattgcggcctcaatgagcacaaccaccacctcatcaatgacttcacagtcaagcagatgagacaaggagccttcctggtgaacacagcccgtggtggcctggtggatgagaaggcactagcccaggccctgaaggaagggcggatccgtggcgcagcgctggacgtgcatgagtcagagcctttcagctttagccagggacccttaaaggatgcacccaacctcatctgcaccccccatgctgcatggtacagtgagcaggcgtccattgagatgcgagaggaggcagcccgggaaatccgacgagccatcacaggccggatcccagatagcttgaaaaactgtgtcaacaaggaccacctgacagctgccacccactgggccagcatggaccctgctgtggtgcaccctgagctcaatggggctgcctacagcaggtaccctccaggtgtggtgagtgtggcccccactggcatcccagctgctgtggaaggtattgttcccagcgccatgtccctgtcccatggcctgccccctgtggcccacccaccccacgctccttctcctggccagactgtcaagcctgaggcggatagagaccatacgactgaccagttgtagcctgtgaggagctctccagccttgacacctggtggagggagctgcacacccttggacccaagtgtgcagaggtgacatccagtgtggccctagcactccagagactggcccgggcgtgcaccaggcggggcaagaggaagcacgtccccaagttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattatt

//