2024-05-20 01:57:37, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_019201 2420 bp mRNA linear ROD 22-MAR-2023 DEFINITION Rattus norvegicus C-terminal binding protein 1 (Ctbp1), mRNA. ACCESSION NM_019201 XM_001062979 XM_001063046 XM_001063097 VERSION NM_019201.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2420) AUTHORS Ivanova D, Imig C, Camacho M, Reinhold A, Guhathakurta D, Montenegro-Venegas C, Cousin MA, Gundelfinger ED, Rosenmund C, Cooper B and Fejtova A. TITLE CtBP1-Mediated Membrane Fission Contributes to Effective Recycling of Synaptic Vesicles JOURNAL Cell Rep 30 (7), 2444-2459 (2020) PUBMED 32075774 REFERENCE 2 (bases 1 to 2420) AUTHORS Fragoza R, Das J, Wierbowski SD, Liang J, Tran TN, Liang S, Beltran JF, Rivera-Erick CA, Ye K, Wang TY, Yao L, Mort M, Stenson PD, Cooper DN, Wei X, Keinan A, Schimenti JC, Clark AG and Yu H. TITLE Extensive disruption of protein interactions by genetic variants across the allele frequency spectrum in human populations JOURNAL Nat Commun 10 (1), 4141 (2019) PUBMED 31515488 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 2420) AUTHORS Hu K, Li Y, Yu H and Hu Y. TITLE CTBP1 Confers Protection for Hippocampal and Cortical Neurons in Rat Models of Alzheimer's Disease JOURNAL Neuroimmunomodulation 26 (3), 139-152 (2019) PUBMED 31340205 REMARK GeneRIF: CTBP1 Confers Protection for Hippocampal and Cortical Neurons in Rat Models of Alzheimer's Disease. REFERENCE 4 (bases 1 to 2420) AUTHORS Rocca DL, Wilkinson KA and Henley JM. TITLE SUMOylation of FOXP1 regulates transcriptional repression via CtBP1 to drive dendritic morphogenesis JOURNAL Sci Rep 7 (1), 877 (2017) PUBMED 28408745 REMARK GeneRIF: Results shed light on the binding of CtBP1 protein to SUMOylated Foxp1 to repress the genetic transcription and drive dendritic morphogenesis. Publication Status: Online-Only REFERENCE 5 (bases 1 to 2420) AUTHORS Yachie N, Petsalaki E, Mellor JC, Weile J, Jacob Y, Verby M, Ozturk SB, Li S, Cote AG, Mosca R, Knapp JJ, Ko M, Yu A, Gebbia M, Sahni N, Yi S, Tyagi T, Sheykhkarimli D, Roth JF, Wong C, Musa L, Snider J, Liu YC, Yu H, Braun P, Stagljar I, Hao T, Calderwood MA, Pelletier L, Aloy P, Hill DE, Vidal M and Roth FP. TITLE Pooled-matrix protein interaction screens using Barcode Fusion Genetics JOURNAL Mol Syst Biol 12 (4), 863 (2016) PUBMED 27107012 REMARK Publication Status: Online-Only REFERENCE 6 (bases 1 to 2420) AUTHORS Chinnadurai G. TITLE CtBP, an unconventional transcriptional corepressor in development and oncogenesis JOURNAL Mol Cell 9 (2), 213-224 (2002) PUBMED 11864595 REMARK GeneRIF: CtBp proteins repress transcription in a histone deacetylase dependent or independent manner. Review article REFERENCE 7 (bases 1 to 2420) AUTHORS Riefler GM and Firestein BL. TITLE Binding of neuronal nitric-oxide synthase (nNOS) to carboxyl-terminal-binding protein (CtBP) changes the localization of CtBP from the nucleus to the cytosol: a novel function for targeting by the PDZ domain of nNOS JOURNAL J Biol Chem 276 (51), 48262-48268 (2001) PUBMED 11590170 REFERENCE 8 (bases 1 to 2420) AUTHORS Spano S, Silletta MG, Colanzi A, Alberti S, Fiucci G, Valente C, Fusella A, Salmona M, Mironov A, Luini A and Corda D. TITLE Molecular cloning and functional characterization of brefeldin A-ADP-ribosylated substrate. A novel protein involved in the maintenance of the Golgi structure JOURNAL J Biol Chem 274 (25), 17705-17710 (1999) PUBMED 10364211 REMARK Erratum:[J Biol Chem 1999 Aug 27;274(35):25188. Spanfo S [corrected to Spano S]] REFERENCE 9 (bases 1 to 2420) AUTHORS Di Girolamo M, Silletta MG, De Matteis MA, Braca A, Colanzi A, Pawlak D, Rasenick MM, Luini A and Corda D. TITLE Evidence that the 50-kDa substrate of brefeldin A-dependent ADP-ribosylation binds GTP and is modulated by the G-protein beta gamma subunit complex JOURNAL Proc Natl Acad Sci U S A 92 (15), 7065-7069 (1995) PUBMED 7624370 REFERENCE 10 (bases 1 to 2420) AUTHORS Belgrader P, Dey R and Berezney R. TITLE Molecular cloning of matrin 3. A 125-kilodalton protein of the nuclear matrix contains an extensive acidic domain JOURNAL J Biol Chem 266 (15), 9893-9899 (1991) PUBMED 2033075 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF067795.2. On Feb 21, 2013 this sequence version replaced NM_019201.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF067795.2 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMD00132261, SAMD00132262 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-2420 AF067795.2 6-2425 FEATURES Location/Qualifiers source 1..2420 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="Sprague-Dawley" /db_xref="taxon:10116" /chromosome="14" /map="14q21" gene 1..2420 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="C-terminal binding protein 1" /db_xref="GeneID:29382" /db_xref="RGD:2441" exon 1..196 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 197..389 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" misc_feature 377..379 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="upstream in-frame stop codon" CDS 383..1675 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="C-terminus binding protein 3/brefeldin A (BFA) adenosine diphosphate-ribosylated substrate; ctBP3; C-terminal-binding protein 3; 50 kDa BFA-dependent ADP-ribosylation substrate; brefeldin A-ADP-riboslyated substrate; 50-kDa BFA-induced ADP-ribosylated substrate" /codon_start=1 /product="C-terminal-binding protein 1" /protein_id="NP_062074.2" /db_xref="GeneID:29382" /db_xref="RGD:2441" /translation="
MSGVRPPIMNGPMHPRPLVALLDGRDCTVEMPILKDVATVAFCDAQSTQEIHEKVLNEAVGALMYHTITLTREDLEKFKALRIIVRIGSGFDNIDIKSAGDLGIAVCNVPAASVEETADSTLCHILNLYRRTTWLHQALREGTRVQSVEQIREVASGAARIRGETLGIIGLGRVGQAVALRAKAFGFNVLFYDPYLSDGIERALGLQRVSTLQDLLFHSDCVTLHCGLNEHNHHLINDFTVKQMRQGAFLVNTARGGLVDEKALAQALKEGRIRGAALDVHESEPFSFSQGPLKDAPNLICTPHAAWYSEQASIEMREEAAREIRRAITGRIPDSLKNCVNKDHLTAATHWASMDPAVVHPELNGAAYSRYPPGVVSVAPTGIPAAVEGIVPSAMSLSHGLPPVAHPPHAPSPGQTVKPEADRDHTTDQL"
misc_feature 383..559 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); Region: Interaction with GLIS2 1. /evidence=ECO:0000250" misc_feature 431..1387 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="C-terminal binding protein (CtBP), D-isomer-specific 2-hydroxyacid dehydrogenases related repressor; Region: CtBP_dh; cd05299" /db_xref="CDD:240624" misc_feature order(638..640,647..652,1145..1147,1292..1294,1301..1303) /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="ligand binding site [chemical binding]; other site" /db_xref="CDD:240624" misc_feature order(647..649,731..733,887..892,896..904,956..970, 1055..1063,1067..1069,1076..1078,1139..1147,1217..1222, 1292..1294,1298..1303) /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="NAD binding site [chemical binding]; other site" /db_xref="CDD:240624" misc_feature 1211..1429 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); Region: Interaction with GLIS2 2. /evidence=ECO:0000250" misc_feature 1247..1249 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q13363; propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); phosphorylation site" misc_feature 1472..1477 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="Cleavage, by CAPN1. /evidence=ECO:0000250|UniProtKB:Q13363; propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); cleavage site" misc_feature 1511..1516 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="Cleavage, by CAPN1. /evidence=ECO:0000250|UniProtKB:Q13363; propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); cleavage site" misc_feature 1574..1672 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1577..1582 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="Cleavage, by CAPN1 and CAPN3. /evidence=ECO:0000250|UniProtKB:Q13363; propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); cleavage site" misc_feature 1616..1618 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q13363; propagated from UniProtKB/Swiss-Prot (Q9Z2F5.3); phosphorylation site" exon 390..544 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 545..689 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 690..896 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 897..1111 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 1112..1242 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 1243..1370 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 1371..1488 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" exon 1489..2420 /gene="Ctbp1" /gene_synonym="50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS" /inference="alignment:Splign:2.1.0" ORIGIN
gcgcggctggcggcgcggtggcggctcggcacggcggtggccggtcgcaggcggccgggcggaatagcagactgcgccgaagccgccccaggcgcagggctcgcggcggcggagagcgccggactcatcggggcccgcggccacccgcgcctttcaatgggcagctcgcacttgctcaacaagggcctgccgctggtaagactttgaacccgacgcaggcttcagtggctgctgtggagcagaagcctgagagctttggttggagacaataagacgtgggatgaggctccgtgacagaacgcggttcggcctggggattctgaagacaaaaagctttggacaggcgaattcatggtcgtggaaaccccgccccaattaagcaatgtcaggcgtccgacctcccatcatgaacgggcccatgcacccccggcccctggtggcgctgctggatggccgggactgcacagtggagatgcctatcctgaaggatgtggccacagtagccttctgtgatgcgcagtccacacaggagatccatgagaaggtactgaatgaggcagtgggcgccctgatgtaccataccatcacactgaccagagaagatctggagaagtttaaagctctcagaatcatcgtccgaattggcagcgggtttgacaacatagacatcaagtcagctggtgatctaggcatcgcagtgtgcaatgtaccagcagcatctgtggaagaaacagcagactccaccctgtgccacattctgaacctataccgacgaactacctggctacaccaggcacttcgggaaggcactcgggtccagagtgtagagcagatccgagaggtggcttcaggagctgccaggatccgtggagagaccttgggcatcattggactaggtcgtgtgggccaggcggtggcacttcgggcaaaggcttttggcttcaacgtcctcttctatgacccatacctatctgatggaatcgagcgggccctggggctgcagcgtgtgagcacactgcaggacctgctcttccacagtgactgcgttaccctgcattgcggcctcaatgagcacaaccaccacctcatcaatgacttcacagtcaagcagatgagacaaggagccttcctggtgaacacagcccgtggtggcctggtggatgagaaggcactagcccaggccctgaaggaagggcggatccgtggcgcagcgctggacgtgcatgagtcagagcctttcagctttagccagggacccttaaaggatgcacccaacctcatctgcaccccccatgctgcatggtacagtgagcaggcgtccattgagatgcgagaggaggcagcccgggaaatccgacgagccatcacaggccggatcccagatagcttgaaaaactgtgtcaacaaggaccacctgacagctgccacccactgggccagcatggaccctgctgtggtgcaccctgagctcaatggggctgcctacagcaggtaccctccaggtgtggtgagtgtggcccccactggcatcccagctgctgtggaaggtattgttcccagcgccatgtccctgtcccatggcctgccccctgtggcccacccaccccacgctccttctcctggccagactgtcaagcctgaggcggatagagaccatacgactgaccagttgtagcctgtgaggagctctccagccttgacacctggtggagggagctgcacacccttggacccaagtgtgcagaggtgacatccagtgtggccctagcactccagagactggcccgggcgtgcaccaggcggggcaagaggaagcacgtccccaagttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]