ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-04-20 22:10:31, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_013137 2921 bp mRNA linear ROD 11-NOV-2023
DEFINITION Rattus norvegicus discoidin domain receptor tyrosine kinase 1
(Ddr1), transcript variant 1, mRNA.
ACCESSION NM_013137
VERSION NM_013137.2
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 2921)
AUTHORS Wu R, Pan S, Chen Y, Nakano Y, Li M, Balog S and Tsukamoto H.
TITLE Fate and functional roles of Prominin 1+ cells in liver injury and
cancer
JOURNAL Sci Rep 10 (1), 19412 (2020)
PUBMED 33173221
REMARK Publication Status: Online-Only
REFERENCE 2 (bases 1 to 2921)
AUTHORS Romayor I, Badiola I, Benedicto A, Marquez J, Herrero A, Arteta B
and Olaso E.
TITLE Silencing of sinusoidal DDR1 reduces murine liver metastasis by
colon carcinoma
JOURNAL Sci Rep 10 (1), 18398 (2020)
PUBMED 33110221
REMARK Publication Status: Online-Only
REFERENCE 3 (bases 1 to 2921)
AUTHORS Lino M, Ngai D, Liu A, Mohabeer A, Harper C, Caruso LL, Schroer SA,
Fu F, McKee T, Giacca A, Woo M and Bendeck MP.
TITLE Discoidin domain receptor 1-deletion ameliorates fibrosis and
promotes adipose tissue beiging, brown fat activity, and increased
metabolic rate in a mouse model of cardiometabolic disease
JOURNAL Mol Metab 39, 101006 (2020)
PUBMED 32360427
REFERENCE 4 (bases 1 to 2921)
AUTHORS Zhong X, Zhang W and Sun T.
TITLE DDR1 promotes breast tumor growth by suppressing antitumor immunity
JOURNAL Oncol Rep 42 (6), 2844-2854 (2019)
PUBMED 31578591
REFERENCE 5 (bases 1 to 2921)
AUTHORS Chiusa M, Hu W, Liao HJ, Su Y, Borza CM, de Caestecker MP, Skrypnyk
NI, Fogo AB, Pedchenko V, Li X, Zhang MZ, Hudson BG, Basak T,
Vanacore RM, Zent R and Pozzi A.
TITLE The Extracellular Matrix Receptor Discoidin Domain Receptor 1
Regulates Collagen Transcription by Translocating to the Nucleus
JOURNAL J Am Soc Nephrol 30 (9), 1605-1624 (2019)
PUBMED 31383731
REFERENCE 6 (bases 1 to 2921)
AUTHORS Vogel WF, Aszodi A, Alves F and Pawson T.
TITLE Discoidin domain receptor 1 tyrosine kinase has an essential role
in mammary gland development
JOURNAL Mol Cell Biol 21 (8), 2906-2917 (2001)
PUBMED 11283268
REFERENCE 7 (bases 1 to 2921)
AUTHORS Chin GS, Lee S, Hsu M, Liu W, Kim WJ, Levinson H and Longaker MT.
TITLE Discoidin domain receptors and their ligand, collagen, are
temporally regulated in fetal rat fibroblasts in vitro
JOURNAL Plast Reconstr Surg 107 (3), 769-776 (2001)
PUBMED 11304604
REFERENCE 8 (bases 1 to 2921)
AUTHORS Bhatt RS, Tomoda T, Fang Y and Hatten ME.
TITLE Discoidin domain receptor 1 functions in axon extension of
cerebellar granule neurons
JOURNAL Genes Dev 14 (17), 2216-2228 (2000)
PUBMED 10970885
REFERENCE 9 (bases 1 to 2921)
AUTHORS Vogel W, Gish GD, Alves F and Pawson T.
TITLE The discoidin domain receptor tyrosine kinases are activated by
collagen
JOURNAL Mol Cell 1 (1), 13-23 (1997)
PUBMED 9659899
REFERENCE 10 (bases 1 to 2921)
AUTHORS Sanchez MP, Tapley P, Saini SS, He B, Pulido D and Barbacid M.
TITLE Multiple tyrosine protein kinases in rat hippocampal neurons:
isolation of Ptk-3, a receptor expressed in proliferative zones of
the developing brain
JOURNAL Proc Natl Acad Sci U S A 91 (5), 1819-1823 (1994)
PUBMED 8127887
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
DN935615.1, BC166604.1 and BX883047.1.
On Oct 3, 2009 this sequence version replaced NM_013137.1.
Transcript Variant: This variant (1) represents the longer
transcript. Variants 1 and 2 encode the same protein.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data. The genomic coordinates used for the
transcript record were based on transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC166604.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMD00132261, SAMD00132262
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on conservation, expression,
longest protein
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-607 DN935615.1 32-638
608-2707 BC166604.1 608-2707
2708-2780 BX883047.1 260674-260746 c
2781-2921 BX883047.1 260414-260554 c
FEATURES Location/Qualifiers
source 1..2921
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="20"
/map="20p12"
gene 1..2921
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="discoidin domain receptor tyrosine kinase 1"
/db_xref="GeneID:25678"
/db_xref="RGD:2252"
exon 1..146
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 147..276
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
CDS 189..2921
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/EC_number="2.7.10.1"
/note="discoidin domain receptor family, member 1;
epithelial discoidin domain-containing receptor 1; cell
adhesion kinase; tyrosine kinase DDR; tyrosine-protein
kinase CAK; protein-tyrosine kinase PTK-3; CD167
antigen-like family member A; discoidin receptor tyrosine
kinase; epithelial discoidin domain receptor 1;
protein-tyrosine kinase 3; neurotrophic tyrosine kinase
receptor type 4"
/codon_start=1
/product="epithelial discoidin domain-containing receptor
1 precursor"
/protein_id="NP_037269.2"
/db_xref="GeneID:25678"
/db_xref="RGD:2252"
/translation="
MGTGTLSSLLLLLLLVTIGDADMKGHFDPAKCRYALGMQDRTIPDSDISVSSSWSDSTAARHSRLESSDGDGAWCPAGPVFPKEEEYLQVDLRRLHLVALVGTQGRHAGGLGKEFSRSYRLRYSRDGRRWMDWKDRWGQEVISGNEDPGGVVLKDLGPPMVARLVRFYPRADRVMSVCLRVELYGCLWRDGLLSYTAPVGQTMQLSEMVYLNDSTYDGYTAGGLQYGGLGQLADGVVGLDDFRQSQELRVWPGYDYVGWSNHSFPSGYVEMEFEFDRLRSFQTMQVHCNNMHTLGARLPGGVECRFKRGPAMAWEGEPVRHALGGSLGDPRARAISVPLGGHVGRFLQCRFLFAGPWLLFSEISFISDVVNDSSDTFPPAPWWPPGPPPTNFSSLELEPRGQQPVAKAEGSPTAILIGCLVAIILLLLLIIALMLWRLHWRRLLSKAERRVLEEELTVHLSVPGDTILINNRPGPREPPPYQEPRPRGTPTHSAPCVPNGSALLLSNPAYRLLLATYARPPRGPGPPTPAWAKPTNTQACSGDYMEPEKPGAPLLPPPPQNSVPHYAEADIVTLQGVTGGNTYAVPALPPGAVGDGPPRVDFPRSRLRFKEKLGEGQFGEVHLCEVEDPQDLVTSDFPISVQKGHPLLVAVKILRPDATKNARNDFLKEVKIMSRLKDPNIIRLLGVCVQDDPLCMITDYMENGDLNQFLSAHQLENKVTQGLPGDRESDQGPTISYPMLLHVGAQIASGMRYLATLNFVHRDLATRNCLVGENFTIKIADFGMSRNLYAGDYYRVQGRAVLPIRWMAWECILMGKFTTASDVWAFGVTLWEVLMLCRSQPFGQLTDEQVIENAGEFFRDQGRQVYLSRPPACPQTLYELMLRCWSREPEQRPPFSQLHRFLADDALNTV"
sig_peptide 189..245
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q63474.1)"
mat_peptide 246..2918
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/product="Epithelial discoidin domain-containing receptor
1. /id=PRO_0000016745"
/note="propagated from UniProtKB/Swiss-Prot (Q63474.1)"
misc_feature 360..743
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Coagulation factor 5/8 C-terminal domain, discoidin
domain; Cell surface-attached carbohydrate-binding domain,
present in eukaryotes and assumed to have horizontally
transferred to eubacterial genomes; Region: FA58C;
cd00057"
/db_xref="CDD:238014"
misc_feature order(411..413,504..506,528..530)
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="sugar binding site [chemical binding]; other site"
/db_xref="CDD:238014"
misc_feature 765..1292
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
Region: DS-like domain. /evidence=ECO:0000250"
misc_feature 822..824
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
misc_feature 969..971
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
misc_feature 1299..1301
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
misc_feature 1359..1361
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="N-linked (GlcNAc...) asparagine.
/evidence=ECO:0000255; propagated from
UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
misc_feature 1431..1493
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
transmembrane region"
misc_feature 1587..1670
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
misc_feature 1620..1631
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
Region: PPxY motif"
misc_feature 1629..1631
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
misc_feature 1716..1718
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
misc_feature 1737..1739
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
misc_feature 1989..2900
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Catalytic domain of the Protein Tyrosine Kinase,
Discoidin Domain Receptor 1; Region: PTKc_DDR1; cd05096"
/db_xref="CDD:133227"
misc_feature order(2025..2039,2049..2051,2136..2138,2142..2144,
2280..2291,2298..2303,2475..2477,2487..2492,2496..2498,
2529..2531,2583..2597,2622..2624,2727..2729)
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="active site"
/db_xref="CDD:133227"
misc_feature order(2025..2030,2034..2039,2049..2051,2136..2138,
2142..2144,2280..2291,2298..2303,2487..2492,2496..2498,
2529..2531)
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:133227"
misc_feature 2397..2399
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
misc_feature order(2475..2477,2487..2489,2583..2597,2622..2624,
2727..2729)
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="polypeptide substrate binding site [polypeptide
binding]; other site"
/db_xref="CDD:133227"
misc_feature 2526..2603
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="activation loop (A-loop); other site"
/db_xref="CDD:133227"
misc_feature 2553..2555
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
misc_feature 2565..2567
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
misc_feature 2568..2570
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/note="Phosphotyrosine, by autocatalysis.
/evidence=ECO:0000250|UniProtKB:Q08345; propagated from
UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
exon 277..379
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 380..608
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 609..756
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 757..856
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 857..1043
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 1044..1290
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 1291..1374
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 1375..1526
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 1527..1692
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 1693..1803
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 1804..2048
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 2049..2176
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 2177..2395
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 2396..2630
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 2631..2780
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
exon 2781..2921
/gene="Ddr1"
/gene_synonym="Cak; Drd1; PTK3D"
/inference="alignment:Splign:2.1.0"
ORIGIN
ggaacaggcccccgacagctgctcgcgggagccgcctcccgacacccgagccccgccggcgcctgagctcccctctcgcgccccgccaccgaggaggccccgagccggggccggacgcctgggtcggcccgggagagccaggagagagatgctgtcccctcctccataggccagagggatcaggagcgatggggacagggaccctctcatctctcctgctgctgctactcttggtgacaattggagatgctgacatgaagggacattttgacccagccaagtgccgctatgccctgggcatgcaggaccgcaccattccagacagcgatatctctgtgtccagctcctggtcggactctaccgccgcccgccacagcaggctggaaagcagtgatggagatggggcttggtgccctgcagggcctgtgttccccaaagaagaggagtacctgcaggtggaccttcgtaggctacacctggtggctctggtgggcacccagggccgccatgctgggggtctgggcaaagagttctcccgaagctaccggttgcgttactcccgagatggccgacgatggatggactggaaagacagatggggtcaggaggtgatttcgggtaacgaggatcctgggggagtggtgctgaaggatctcgggccccccatggtggcccggctggtccgtttctaccccagggctgaccgggtcatgagtgtctgtcttcgggtggagctctatggctgcctctggcgggacggactcttgtcctatacagcccccgtggggcagaccatgcaattatctgagatggtgtatctcaatgattccacttacgatggatatactgctggagggctgcagtacggtggtctgggccaactggcagacggcgtggtggggctggatgatttcaggcagagccaggagctgcgggtttggccaggctatgactatgtgggatggagcaaccatagcttccccagcggctacgtggagatggagtttgagtttgaccggctgaggtctttccagaccatgcaggtccactgtaacaacatgcacactctgggagcccgcctcccaggcggggtggaatgccggtttaaaaggggtccggccatggcctgggaaggagagcctgtacgccatgccctggggggtagccttggagaccccagagccagggccatctcggtgcccctgggtggtcacgtgggccgcttcctgcagtgcagattcctctttgcaggaccctggttactcttcagtgagatctctttcatctcggatgtggtgaacgactcgtctgacaccttcccaccagccccctggtggccgcctggcccgcctcccaccaacttcagcagcttggagctggagccccggggtcaacagcctgtggccaaggcggaggggagcccaactgccatcctcattggctgcctggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttggggaggtacatctctgtgaagtagaggaccctcaagatctggtcactagtgacttccctatcagtgtgcaaaagggacaccccttgctggtggcagtgaagatcctccggccagatgccaccaaaaatgccaggaatgacttcctgaaggaggtaaagatcatgtcacggctgaaggacccaaacatcatccggctcctgggtgtgtgtgtgcaggatgaccctctctgcatgattacagactacatggagaacggtgacctgaaccaattcctcagtgcccaccagctggagaacaaggtcactcaggggcttcctggggacagagagtctgaccaggggcccacaatcagctaccctatgctgttacacgtgggggcccagatcgcctctggcatgcgatatctggccacccttaactttgtgcatcgggacctggccacccggaactgcttggttggggaaaatttcaccatcaaaatcgccgactttggcatgagccggaatctctacgctggggattattaccgtgtacagggccgggcagtgctgcccatcaggtggatggcctgggagtgtatcctcatggggaagttcacaacagccagtgatgtgtgggccttcggagtgaccctgtgggaggtgcttatgctctgcaggtcacagcccttcgggcaactcacagacgagcaggtcatcgagaacgccggcgagttcttcagggaccagggccggcaggtatacttatccaggccacccgcctgcccgcagaccttgtatgagctgatgctccggtgttggagccgggagccggagcagcggccgcccttctcccagcttcatcggttcctggcggatgatgcactcaacacagtgtaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]