GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-03 09:14:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_013137               2921 bp    mRNA    linear   ROD 11-NOV-2023
DEFINITION  Rattus norvegicus discoidin domain receptor tyrosine kinase 1
            (Ddr1), transcript variant 1, mRNA.
ACCESSION   NM_013137
VERSION     NM_013137.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2921)
  AUTHORS   Wu R, Pan S, Chen Y, Nakano Y, Li M, Balog S and Tsukamoto H.
  TITLE     Fate and functional roles of Prominin 1+ cells in liver injury and
            cancer
  JOURNAL   Sci Rep 10 (1), 19412 (2020)
   PUBMED   33173221
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 2921)
  AUTHORS   Romayor I, Badiola I, Benedicto A, Marquez J, Herrero A, Arteta B
            and Olaso E.
  TITLE     Silencing of sinusoidal DDR1 reduces murine liver metastasis by
            colon carcinoma
  JOURNAL   Sci Rep 10 (1), 18398 (2020)
   PUBMED   33110221
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 2921)
  AUTHORS   Lino M, Ngai D, Liu A, Mohabeer A, Harper C, Caruso LL, Schroer SA,
            Fu F, McKee T, Giacca A, Woo M and Bendeck MP.
  TITLE     Discoidin domain receptor 1-deletion ameliorates fibrosis and
            promotes adipose tissue beiging, brown fat activity, and increased
            metabolic rate in a mouse model of cardiometabolic disease
  JOURNAL   Mol Metab 39, 101006 (2020)
   PUBMED   32360427
REFERENCE   4  (bases 1 to 2921)
  AUTHORS   Zhong X, Zhang W and Sun T.
  TITLE     DDR1 promotes breast tumor growth by suppressing antitumor immunity
  JOURNAL   Oncol Rep 42 (6), 2844-2854 (2019)
   PUBMED   31578591
REFERENCE   5  (bases 1 to 2921)
  AUTHORS   Chiusa M, Hu W, Liao HJ, Su Y, Borza CM, de Caestecker MP, Skrypnyk
            NI, Fogo AB, Pedchenko V, Li X, Zhang MZ, Hudson BG, Basak T,
            Vanacore RM, Zent R and Pozzi A.
  TITLE     The Extracellular Matrix Receptor Discoidin Domain Receptor 1
            Regulates Collagen Transcription by Translocating to the Nucleus
  JOURNAL   J Am Soc Nephrol 30 (9), 1605-1624 (2019)
   PUBMED   31383731
REFERENCE   6  (bases 1 to 2921)
  AUTHORS   Vogel WF, Aszodi A, Alves F and Pawson T.
  TITLE     Discoidin domain receptor 1 tyrosine kinase has an essential role
            in mammary gland development
  JOURNAL   Mol Cell Biol 21 (8), 2906-2917 (2001)
   PUBMED   11283268
REFERENCE   7  (bases 1 to 2921)
  AUTHORS   Chin GS, Lee S, Hsu M, Liu W, Kim WJ, Levinson H and Longaker MT.
  TITLE     Discoidin domain receptors and their ligand, collagen, are
            temporally regulated in fetal rat fibroblasts in vitro
  JOURNAL   Plast Reconstr Surg 107 (3), 769-776 (2001)
   PUBMED   11304604
REFERENCE   8  (bases 1 to 2921)
  AUTHORS   Bhatt RS, Tomoda T, Fang Y and Hatten ME.
  TITLE     Discoidin domain receptor 1 functions in axon extension of
            cerebellar granule neurons
  JOURNAL   Genes Dev 14 (17), 2216-2228 (2000)
   PUBMED   10970885
REFERENCE   9  (bases 1 to 2921)
  AUTHORS   Vogel W, Gish GD, Alves F and Pawson T.
  TITLE     The discoidin domain receptor tyrosine kinases are activated by
            collagen
  JOURNAL   Mol Cell 1 (1), 13-23 (1997)
   PUBMED   9659899
REFERENCE   10 (bases 1 to 2921)
  AUTHORS   Sanchez MP, Tapley P, Saini SS, He B, Pulido D and Barbacid M.
  TITLE     Multiple tyrosine protein kinases in rat hippocampal neurons:
            isolation of Ptk-3, a receptor expressed in proliferative zones of
            the developing brain
  JOURNAL   Proc Natl Acad Sci U S A 91 (5), 1819-1823 (1994)
   PUBMED   8127887
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DN935615.1, BC166604.1 and BX883047.1.
            
            On Oct 3, 2009 this sequence version replaced NM_013137.1.
            
            Transcript Variant: This variant (1) represents the longer
            transcript. Variants 1 and 2 encode the same protein.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC166604.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-607               DN935615.1         32-638
            608-2707            BC166604.1         608-2707
            2708-2780           BX883047.1         260674-260746       c
            2781-2921           BX883047.1         260414-260554       c
FEATURES             Location/Qualifiers
     source          1..2921
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="20"
                     /map="20p12"
     gene            1..2921
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="discoidin domain receptor tyrosine kinase 1"
                     /db_xref="GeneID:25678"
                     /db_xref="RGD:2252"
     exon            1..146
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            147..276
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     CDS             189..2921
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /EC_number="2.7.10.1"
                     /note="discoidin domain receptor family, member 1;
                     epithelial discoidin domain-containing receptor 1; cell
                     adhesion kinase; tyrosine kinase DDR; tyrosine-protein
                     kinase CAK; protein-tyrosine kinase PTK-3; CD167
                     antigen-like family member A; discoidin receptor tyrosine
                     kinase; epithelial discoidin domain receptor 1;
                     protein-tyrosine kinase 3; neurotrophic tyrosine kinase
                     receptor type 4"
                     /codon_start=1
                     /product="epithelial discoidin domain-containing receptor
                     1 precursor"
                     /protein_id="NP_037269.2"
                     /db_xref="GeneID:25678"
                     /db_xref="RGD:2252"
                     /translation="
MGTGTLSSLLLLLLLVTIGDADMKGHFDPAKCRYALGMQDRTIPDSDISVSSSWSDSTAARHSRLESSDGDGAWCPAGPVFPKEEEYLQVDLRRLHLVALVGTQGRHAGGLGKEFSRSYRLRYSRDGRRWMDWKDRWGQEVISGNEDPGGVVLKDLGPPMVARLVRFYPRADRVMSVCLRVELYGCLWRDGLLSYTAPVGQTMQLSEMVYLNDSTYDGYTAGGLQYGGLGQLADGVVGLDDFRQSQELRVWPGYDYVGWSNHSFPSGYVEMEFEFDRLRSFQTMQVHCNNMHTLGARLPGGVECRFKRGPAMAWEGEPVRHALGGSLGDPRARAISVPLGGHVGRFLQCRFLFAGPWLLFSEISFISDVVNDSSDTFPPAPWWPPGPPPTNFSSLELEPRGQQPVAKAEGSPTAILIGCLVAIILLLLLIIALMLWRLHWRRLLSKAERRVLEEELTVHLSVPGDTILINNRPGPREPPPYQEPRPRGTPTHSAPCVPNGSALLLSNPAYRLLLATYARPPRGPGPPTPAWAKPTNTQACSGDYMEPEKPGAPLLPPPPQNSVPHYAEADIVTLQGVTGGNTYAVPALPPGAVGDGPPRVDFPRSRLRFKEKLGEGQFGEVHLCEVEDPQDLVTSDFPISVQKGHPLLVAVKILRPDATKNARNDFLKEVKIMSRLKDPNIIRLLGVCVQDDPLCMITDYMENGDLNQFLSAHQLENKVTQGLPGDRESDQGPTISYPMLLHVGAQIASGMRYLATLNFVHRDLATRNCLVGENFTIKIADFGMSRNLYAGDYYRVQGRAVLPIRWMAWECILMGKFTTASDVWAFGVTLWEVLMLCRSQPFGQLTDEQVIENAGEFFRDQGRQVYLSRPPACPQTLYELMLRCWSREPEQRPPFSQLHRFLADDALNTV"
     sig_peptide     189..245
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="/evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1)"
     mat_peptide     246..2918
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /product="Epithelial discoidin domain-containing receptor
                     1. /id=PRO_0000016745"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63474.1)"
     misc_feature    360..743
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Coagulation factor 5/8 C-terminal domain, discoidin
                     domain; Cell surface-attached carbohydrate-binding domain,
                     present in eukaryotes and assumed to have horizontally
                     transferred to eubacterial genomes; Region: FA58C;
                     cd00057"
                     /db_xref="CDD:238014"
     misc_feature    order(411..413,504..506,528..530)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="sugar binding site [chemical binding]; other site"
                     /db_xref="CDD:238014"
     misc_feature    765..1292
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
                     Region: DS-like domain. /evidence=ECO:0000250"
     misc_feature    822..824
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
     misc_feature    969..971
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
     misc_feature    1299..1301
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
     misc_feature    1359..1361
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); glycosylation site"
     misc_feature    1431..1493
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
                     transmembrane region"
     misc_feature    1587..1670
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1620..1631
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="propagated from UniProtKB/Swiss-Prot (Q63474.1);
                     Region: PPxY motif"
     misc_feature    1629..1631
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     misc_feature    1716..1718
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     misc_feature    1737..1739
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     misc_feature    1989..2900
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Catalytic domain of the Protein Tyrosine Kinase,
                     Discoidin Domain Receptor 1; Region: PTKc_DDR1; cd05096"
                     /db_xref="CDD:133227"
     misc_feature    order(2025..2039,2049..2051,2136..2138,2142..2144,
                     2280..2291,2298..2303,2475..2477,2487..2492,2496..2498,
                     2529..2531,2583..2597,2622..2624,2727..2729)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="active site"
                     /db_xref="CDD:133227"
     misc_feature    order(2025..2030,2034..2039,2049..2051,2136..2138,
                     2142..2144,2280..2291,2298..2303,2487..2492,2496..2498,
                     2529..2531)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:133227"
     misc_feature    2397..2399
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     misc_feature    order(2475..2477,2487..2489,2583..2597,2622..2624,
                     2727..2729)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:133227"
     misc_feature    2526..2603
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:133227"
     misc_feature    2553..2555
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     misc_feature    2565..2567
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     misc_feature    2568..2570
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Phosphotyrosine, by autocatalysis.
                     /evidence=ECO:0000250|UniProtKB:Q08345; propagated from
                     UniProtKB/Swiss-Prot (Q63474.1); phosphorylation site"
     exon            277..379
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            380..608
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            609..756
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            757..856
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            857..1043
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            1044..1290
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            1291..1374
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            1375..1526
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            1527..1692
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            1693..1803
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            1804..2048
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            2049..2176
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            2177..2395
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            2396..2630
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            2631..2780
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
     exon            2781..2921
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
ggaacaggcccccgacagctgctcgcgggagccgcctcccgacacccgagccccgccggcgcctgagctcccctctcgcgccccgccaccgaggaggccccgagccggggccggacgcctgggtcggcccgggagagccaggagagagatgctgtcccctcctccataggccagagggatcaggagcgatggggacagggaccctctcatctctcctgctgctgctactcttggtgacaattggagatgctgacatgaagggacattttgacccagccaagtgccgctatgccctgggcatgcaggaccgcaccattccagacagcgatatctctgtgtccagctcctggtcggactctaccgccgcccgccacagcaggctggaaagcagtgatggagatggggcttggtgccctgcagggcctgtgttccccaaagaagaggagtacctgcaggtggaccttcgtaggctacacctggtggctctggtgggcacccagggccgccatgctgggggtctgggcaaagagttctcccgaagctaccggttgcgttactcccgagatggccgacgatggatggactggaaagacagatggggtcaggaggtgatttcgggtaacgaggatcctgggggagtggtgctgaaggatctcgggccccccatggtggcccggctggtccgtttctaccccagggctgaccgggtcatgagtgtctgtcttcgggtggagctctatggctgcctctggcgggacggactcttgtcctatacagcccccgtggggcagaccatgcaattatctgagatggtgtatctcaatgattccacttacgatggatatactgctggagggctgcagtacggtggtctgggccaactggcagacggcgtggtggggctggatgatttcaggcagagccaggagctgcgggtttggccaggctatgactatgtgggatggagcaaccatagcttccccagcggctacgtggagatggagtttgagtttgaccggctgaggtctttccagaccatgcaggtccactgtaacaacatgcacactctgggagcccgcctcccaggcggggtggaatgccggtttaaaaggggtccggccatggcctgggaaggagagcctgtacgccatgccctggggggtagccttggagaccccagagccagggccatctcggtgcccctgggtggtcacgtgggccgcttcctgcagtgcagattcctctttgcaggaccctggttactcttcagtgagatctctttcatctcggatgtggtgaacgactcgtctgacaccttcccaccagccccctggtggccgcctggcccgcctcccaccaacttcagcagcttggagctggagccccggggtcaacagcctgtggccaaggcggaggggagcccaactgccatcctcattggctgcctggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttggggaggtacatctctgtgaagtagaggaccctcaagatctggtcactagtgacttccctatcagtgtgcaaaagggacaccccttgctggtggcagtgaagatcctccggccagatgccaccaaaaatgccaggaatgacttcctgaaggaggtaaagatcatgtcacggctgaaggacccaaacatcatccggctcctgggtgtgtgtgtgcaggatgaccctctctgcatgattacagactacatggagaacggtgacctgaaccaattcctcagtgcccaccagctggagaacaaggtcactcaggggcttcctggggacagagagtctgaccaggggcccacaatcagctaccctatgctgttacacgtgggggcccagatcgcctctggcatgcgatatctggccacccttaactttgtgcatcgggacctggccacccggaactgcttggttggggaaaatttcaccatcaaaatcgccgactttggcatgagccggaatctctacgctggggattattaccgtgtacagggccgggcagtgctgcccatcaggtggatggcctgggagtgtatcctcatggggaagttcacaacagccagtgatgtgtgggccttcggagtgaccctgtgggaggtgcttatgctctgcaggtcacagcccttcgggcaactcacagacgagcaggtcatcgagaacgccggcgagttcttcagggaccagggccggcaggtatacttatccaggccacccgcctgcccgcagaccttgtatgagctgatgctccggtgttggagccgggagccggagcagcggccgcccttctcccagcttcatcggttcctggcggatgatgcactcaacacagtgtaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]