2025-07-15 06:49:30, GGRNA.v2 : RefSeq release 229 (Mar, 2025)
LOCUS NM_012794 584 bp mRNA linear ROD 31-MAR-2024 DEFINITION Rattus norvegicus glycosylation dependent cell adhesion molecule 1 (Glycam1), mRNA. ACCESSION NM_012794 VERSION NM_012794.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 584) AUTHORS Dowbenko,D., Watson,S.R. and Lasky,L.A. TITLE Cloning of a rat homologue of mouse GlyCAM 1 reveals conservation of structural domains JOURNAL J Biol Chem 268 (19), 14399-14403 (1993) PUBMED 8100229 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from JAXUCZ010000007.1. On Nov 26, 2020 this sequence version replaced NM_012794.1. ##Evidence-Data-START## Transcript exon combination :: L08100.1, BM390037.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760433, SAMN12840105 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-85 JAXUCZ010000007.1 136561215-136561299 c 86-130 JAXUCZ010000007.1 136560437-136560481 c 131-334 JAXUCZ010000007.1 136559527-136559730 c 335-584 JAXUCZ010000007.1 136559039-136559288 c FEATURES Location/Qualifiers source 1..584 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="7" /map="7q36" gene 1..584 /gene="Glycam1" /note="glycosylation dependent cell adhesion molecule 1" /db_xref="GeneID:25258" /db_xref="RGD:2712" exon 1..85 /gene="Glycam1" /inference="alignment:Splign:2.1.0" CDS 22..462 /gene="Glycam1" /note="SGP50; glyCAM-1; sulfated 50 kDa glycoprotein; endothelial ligand FOR L-selectin" /codon_start=1 /product="glycosylation-dependent cell adhesion molecule 1 precursor" /protein_id="NP_036926.2" /db_xref="GeneID:25258" /db_xref="RGD:2712" /translation="
MKFFTVLLFASLAATSLAAVPGSKDELHLRTQPTDAIPASQFTPSSHISKESTSSKDLSKESSIFNEELVSEDNVGTESTKPQSQEAQDGLRSGSSQQEETTSAATSEGKLTMLSQAVQKELGKVIEGFISGVEDIISGASGTVRP"
sig_peptide 22..78 /gene="Glycam1" /note="/evidence=ECO:0000255; propagated from UniProtKB/Swiss-Prot (Q04807.1)" mat_peptide 79..459 /gene="Glycam1" /product="Glycosylation-dependent cell adhesion molecule 1. /id=PRO_0000025407" /note="propagated from UniProtKB/Swiss-Prot (Q04807.1)" misc_feature 79..459 /gene="Glycam1" /note="Glycosylation-dependent cell adhesion molecule 1 (GlyCAM-1); Region: GLYCAM-1; pfam05242" /db_xref="CDD:368355" misc_feature 94..357 /gene="Glycam1" /note="propagated from UniProtKB/Swiss-Prot (Q04807.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 181..183 /gene="Glycam1" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P80195; propagated from UniProtKB/Swiss-Prot (Q04807.1); phosphorylation site" misc_feature 196..198 /gene="Glycam1" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P80195; propagated from UniProtKB/Swiss-Prot (Q04807.1); phosphorylation site" misc_feature 232..234 /gene="Glycam1" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P80195; propagated from UniProtKB/Swiss-Prot (Q04807.1); phosphorylation site" exon 86..130 /gene="Glycam1" /inference="alignment:Splign:2.1.0" exon 131..334 /gene="Glycam1" /inference="alignment:Splign:2.1.0" exon 335..584 /gene="Glycam1" /inference="alignment:Splign:2.1.0" ORIGIN
ctgacctgttccagtgccaccatgaaattcttcactgtcctgctatttgccagccttgctgccacctctcttgctgccgtgcctgggtccaaagatgaactccacctgaggactcagcccacagatgccattccagcttcccagttcactccttccagccacatcagcaaggagagcacttccagtaaggacctttccaaggagtcttccatcttcaacgaagagctggtgtccgaagataatgtggggacagaatctaccaaaccacagagtcaagaggcccaggacgggctcaggagtgggtcatctcagcaggaagagaccacctcagctgcaacctcagagggaaaactgaccatgctgagccaggcagtgcagaaagaactgggtaaagtaattgaaggatttataagtggtgtggaagacataatctctggtgccagtggtaccgtgaggccctgaagacaaaaacgcctaaccgctaagtcccacgctaggtggcgccttcatcacccacattctgctcatctgaccaccacctcttggtctgccctttgatgtcttacattaaagtactgcaaccg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]