GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 14:41:08, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001270859            1345 bp    mRNA    linear   ROD 24-DEC-2022
DEFINITION  Rattus norvegicus stathmin 4 (Stmn4), transcript variant 6, mRNA.
ACCESSION   NM_001270859
VERSION     NM_001270859.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1345)
  AUTHORS   Nakazawa T, Morii H, Tamai M and Mori N.
  TITLE     Selective upregulation of RB3/stathmin4 by ciliary neurotrophic
            factor following optic nerve axotomy
  JOURNAL   Brain Res 1061 (2), 97-106 (2005)
   PUBMED   16256088
  REMARK    GeneRIF: RB3 is the unique response protein in the stathmin-related
            proteins following optic nerve axotomy and the induced RB3 may play
            a critical role in the CNTF-induced response on the axotomized
            retinal ganglion cells
REFERENCE   2  (bases 1 to 1345)
  AUTHORS   Nakao C, Itoh TJ, Hotani H and Mori N.
  TITLE     Modulation of the stathmin-like microtubule destabilizing activity
            of RB3, a neuron-specific member of the SCG10 family, by its
            N-terminal domain
  JOURNAL   J Biol Chem 279 (22), 23014-23021 (2004)
   PUBMED   15039434
  REMARK    GeneRIF: regulatory role of the unique N-terminal domain of RB3 in
            microtubule dynamics would contribute to the physiological
            regulation of neuronal morphogenesis
REFERENCE   3  (bases 1 to 1345)
  AUTHORS   Ozon S, El Mestikawy S and Sobel A.
  TITLE     Differential, regional, and cellular expression of the stathmin
            family transcripts in the adult rat brain
  JOURNAL   J Neurosci Res 56 (5), 553-564 (1999)
   PUBMED   10369222
REFERENCE   4  (bases 1 to 1345)
  AUTHORS   Gavet O, Ozon S, Manceau V, Lawler S, Curmi P and Sobel A.
  TITLE     The stathmin phosphoprotein family: intracellular localization and
            effects on the microtubule network
  JOURNAL   J Cell Sci 111 (Pt 22), 3333-3346 (1998)
   PUBMED   9788875
REFERENCE   5  (bases 1 to 1345)
  AUTHORS   Ozon S, Byk T and Sobel A.
  TITLE     SCLIP: a novel SCG10-like protein of the stathmin family expressed
            in the nervous system
  JOURNAL   J Neurochem 70 (6), 2386-2396 (1998)
   PUBMED   9603203
REFERENCE   6  (bases 1 to 1345)
  AUTHORS   Ozon S, Maucuer A and Sobel A.
  TITLE     The stathmin family -- molecular and biological characterization of
            novel mammalian proteins expressed in the nervous system
  JOURNAL   Eur J Biochem 248 (3), 794-806 (1997)
   PUBMED   9342231
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CB580507.1 and BC092646.1.
            
            Transcript Variant: This variant (6) differs in the 5' UTR and has
            an alternate exon in the 3' end compared to variant 1. This exon
            has an in-frame stop codon, resulting in an isoform (b) with a
            shorter and distinct C-terminus compared to isoform a. Variants 2
            and 6 both encode the same isoform (b).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            CDS exon combination :: BC092646.1, CO398144.1 [ECO:0000331]
            RNAseq introns       :: single sample supports all introns
                                    SAMEA5760389, SAMEA5760393 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-32                CB580507.1         1-32
            33-1345             BC092646.1         39-1351
FEATURES             Location/Qualifiers
     source          1..1345
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="15"
                     /map="15p12"
     gene            1..1345
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /note="stathmin 4"
                     /db_xref="GeneID:79423"
                     /db_xref="RGD:69349"
     exon            1..32
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     exon            33..123
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    60..62
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /note="upstream in-frame stop codon"
     CDS             111..722
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /note="isoform b is encoded by transcript variant 6;
                     stathmin-like protein B3; stathmin-like-protein RB3;
                     stathmin-like 4"
                     /codon_start=1
                     /product="stathmin-4 isoform b"
                     /protein_id="NP_001257788.1"
                     /db_xref="GeneID:79423"
                     /db_xref="RGD:69349"
                     /translation="
MTLAAYKEKMKELPLVSLFCSCFLSDPLNKSSYKYEGWCGRQCRRKGQSQRKGSADWRERREQADTVDLNWCVISDMEVIELNKCTSGQSFEVILKPPSFDGVPEFNASLPRRRDPSLEEIQKKLEAAEERRKYQEAELLKHLAEKREHEREVIQKAIEENNNFIKMAKEKLAQKMESNKENREAHLAAMLERLQEKEPPAAR"
     misc_feature    336..704
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /note="Stathmin family; Region: Stathmin; pfam00836"
                     /db_xref="CDD:425897"
     exon            124..219
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     exon            220..300
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     exon            301..509
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     exon            510..701
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     exon            702..754
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
     exon            755..1344
                     /gene="Stmn4"
                     /gene_synonym="Lagl; Rb3"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gagaacagctcgctttggaaaccggactgcaggattgtgatccagttctgagctggtgataaacactccttgtgacttttggtcaattcagctaccagattccagccaacatgaccctcgcagcctataaggagaagatgaaggaactcccactagtgtctctgttctgctcctgttttctgtctgatcccctgaataaatcatcctacaaatatgaaggctggtgtgggagacagtgtaggaggaaaggtcaaagccagcggaaaggcagtgctgactggagagaaagaagagaacaggcagatacggtagacctgaactggtgtgtcatctctgatatggaagtcatcgagctgaataagtgtacctcgggccagtcctttgaagtcatcctgaagccaccttcctttgacggggtgcctgagtttaatgcctccctcccaagacgtcgagacccatcgctagaagagatacagaagaagctagaagcagcagaggagcgaaggaagtaccaggaagctgagctcctaaaacaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggagccgcctgctgcgcggtgactcccgggaccgatcggtggcctcgtcccatggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacagaagttcagagtgaagggccgagtcctggtggggtggtgtgcagggccagcaggacgagcccgtctggatggagtgaaacctaccctgagcgggtgggataaggtctgtgtgcgtctgttcattgtcatcttttgatcatcatgaccaacgaaacatttaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]