2024-05-02 11:10:35, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001270858 1333 bp mRNA linear ROD 23-DEC-2022 DEFINITION Rattus norvegicus stathmin 4 (Stmn4), transcript variant 5, mRNA. ACCESSION NM_001270858 VERSION NM_001270858.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1333) AUTHORS Nakazawa T, Morii H, Tamai M and Mori N. TITLE Selective upregulation of RB3/stathmin4 by ciliary neurotrophic factor following optic nerve axotomy JOURNAL Brain Res 1061 (2), 97-106 (2005) PUBMED 16256088 REMARK GeneRIF: RB3 is the unique response protein in the stathmin-related proteins following optic nerve axotomy and the induced RB3 may play a critical role in the CNTF-induced response on the axotomized retinal ganglion cells REFERENCE 2 (bases 1 to 1333) AUTHORS Nakao C, Itoh TJ, Hotani H and Mori N. TITLE Modulation of the stathmin-like microtubule destabilizing activity of RB3, a neuron-specific member of the SCG10 family, by its N-terminal domain JOURNAL J Biol Chem 279 (22), 23014-23021 (2004) PUBMED 15039434 REMARK GeneRIF: regulatory role of the unique N-terminal domain of RB3 in microtubule dynamics would contribute to the physiological regulation of neuronal morphogenesis REFERENCE 3 (bases 1 to 1333) AUTHORS Ozon S, El Mestikawy S and Sobel A. TITLE Differential, regional, and cellular expression of the stathmin family transcripts in the adult rat brain JOURNAL J Neurosci Res 56 (5), 553-564 (1999) PUBMED 10369222 REFERENCE 4 (bases 1 to 1333) AUTHORS Gavet O, Ozon S, Manceau V, Lawler S, Curmi P and Sobel A. TITLE The stathmin phosphoprotein family: intracellular localization and effects on the microtubule network JOURNAL J Cell Sci 111 (Pt 22), 3333-3346 (1998) PUBMED 9788875 REFERENCE 5 (bases 1 to 1333) AUTHORS Ozon S, Byk T and Sobel A. TITLE SCLIP: a novel SCG10-like protein of the stathmin family expressed in the nervous system JOURNAL J Neurochem 70 (6), 2386-2396 (1998) PUBMED 9603203 REFERENCE 6 (bases 1 to 1333) AUTHORS Ozon S, Maucuer A and Sobel A. TITLE The stathmin family -- molecular and biological characterization of novel mammalian proteins expressed in the nervous system JOURNAL Eur J Biochem 248 (3), 794-806 (1997) PUBMED 9342231 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000270.1 and BC092646.1. Transcript Variant: This variant (5) lacks an alternate in-frame exon and has an alternate exon in the 3' end compared to variant 1. This additional exon has an in-frame stop codon, resulting in an isoform (e) with a shorter and distinct C-terminus and lacking an alternate internal segment compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: AF026529.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5760393, SAMEA5760396 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-63 JACYVU010000270.1 7111935-7111997 64-288 BC092646.1 1-225 289-1333 BC092646.1 307-1351 FEATURES Location/Qualifiers source 1..1333 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="15" /map="15p12" gene 1..1333 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /note="stathmin 4" /db_xref="GeneID:79423" /db_xref="RGD:69349" exon 1..101 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" exon 102..192 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" misc_feature 129..131 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /note="upstream in-frame stop codon" CDS 180..710 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /note="isoform e is encoded by transcript variant 5; stathmin-like protein B3; stathmin-like-protein RB3; stathmin-like 4" /codon_start=1 /product="stathmin-4 isoform e" /protein_id="NP_001257787.1" /db_xref="GeneID:79423" /db_xref="RGD:69349" /translation="
MTLAAYKEKMKELPLVSLFCSCFLSDPLNKSSYKYEADTVDLNWCVISDMEVIELNKCTSGQSFEVILKPPSFDGVPEFNASLPRRRDPSLEEIQKKLEAAEERRKYQEAELLKHLAEKREHEREVIQKAIEENNNFIKMAKEKLAQKMESNKENREAHLAAMLERLQEKEPPAAR"
misc_feature 324..692 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /note="Stathmin family; Region: Stathmin; pfam00836" /db_xref="CDD:425897" misc_feature 339..341 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P63043.1); phosphorylation site" misc_feature 447..449 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P63043.1); phosphorylation site" exon 193..288 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" exon 289..497 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" exon 498..689 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" exon 690..742 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" exon 743..1332 /gene="Stmn4" /gene_synonym="Lagl; Rb3" /inference="alignment:Splign:2.1.0" ORIGIN
tggcgagagcccagcagtggtgctgatgttgagagaagctcagggtaccactaattgaaggagtgagaagagaacagctcgctttggaaaccggactgcaggattgtgatccagttctgagctggtgataaacactccttgtgacttttggtcaattcagctaccagattccagccaacatgaccctcgcagcctataaggagaagatgaaggaactcccactagtgtctctgttctgctcctgttttctgtctgatcccctgaataaatcatcctacaaatatgaagcagatacggtagacctgaactggtgtgtcatctctgatatggaagtcatcgagctgaataagtgtacctcgggccagtcctttgaagtcatcctgaagccaccttcctttgacggggtgcctgagtttaatgcctccctcccaagacgtcgagacccatcgctagaagagatacagaagaagctagaagcagcagaggagcgaaggaagtaccaggaagctgagctcctaaaacaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggagccgcctgctgcgcggtgactcccgggaccgatcggtggcctcgtcccatggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacagaagttcagagtgaagggccgagtcctggtggggtggtgtgcagggccagcaggacgagcccgtctggatggagtgaaacctaccctgagcgggtgggataaggtctgtgtgcgtctgttcattgtcatcttttgatcatcatgaccaacgaaacatttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]