ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-27 21:21:54, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_001192014 738 bp mRNA linear ROD 03-APR-2025
DEFINITION Rattus norvegicus notochord homeobox (Noto), mRNA.
ACCESSION NM_001192014 XM_578357
VERSION NM_001192014.1
KEYWORDS RefSeq; RefSeq Select.
SOURCE Rattus norvegicus (Norway rat)
ORGANISM Rattus norvegicus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Rattus.
REFERENCE 1 (bases 1 to 738)
AUTHORS Alten,L., Schuster-Gossler,K., Beckers,A., Groos,S., Ulmer,B.,
Hegermann,J., Ochs,M. and Gossler,A.
TITLE Differential regulation of node formation, nodal ciliogenesis and
cilia positioning by Noto and Foxj1
JOURNAL Development 139 (7), 1276-1284 (2012)
PUBMED 22357932
REFERENCE 2 (bases 1 to 738)
AUTHORS Vidigal,J.A., Morkel,M., Wittler,L., Brouwer-Lehmitz,A., Grote,P.,
Macura,K. and Herrmann,B.G.
TITLE An inducible RNA interference system for the functional dissection
of mouse embryogenesis
JOURNAL Nucleic Acids Res 38 (11), e122 (2010)
PUBMED 20350929
REFERENCE 3 (bases 1 to 738)
AUTHORS Zizic Mitrecic,M., Mitrecic,D., Pochet,R., Kostovic-Knezevic,L. and
Gajovic,S.
TITLE The mouse gene Noto is expressed in the tail bud and essential for
its morphogenesis
JOURNAL Cells Tissues Organs 192 (2), 85-92 (2010)
PUBMED 20197654
REFERENCE 4 (bases 1 to 738)
AUTHORS Beckers,A., Alten,L., Viebahn,C., Andre,P. and Gossler,A.
TITLE The mouse homeobox gene Noto regulates node morphogenesis,
notochordal ciliogenesis, and left right patterning
JOURNAL Proc Natl Acad Sci U S A 104 (40), 15765-15770 (2007)
PUBMED 17884984
REMARK Erratum:[Proc Natl Acad Sci U S A. 2007 Oct 30;104(44):17554]
REFERENCE 5 (bases 1 to 738)
AUTHORS Abdelkhalek,H.B., Beckers,A., Schuster-Gossler,K., Pavlova,M.N.,
Burkhardt,H., Lickert,H., Rossant,J., Reinhardt,R., Schalkwyk,L.C.,
Muller,I., Herrmann,B.G., Ceolin,M., Rivera-Pomar,R. and Gossler,A.
TITLE The mouse homeobox gene Not is required for caudal notochord
development and affected by the truncate mutation
JOURNAL Genes Dev 18 (14), 1725-1736 (2004)
PUBMED 15231714
REFERENCE 6 (bases 1 to 738)
AUTHORS Mitrecic,D., Kostovic-Knezevic,L. and Gajovic,S.
TITLE Morphological features of tail bud development in truncate mouse
mutants
JOURNAL Cells Tissues Organs 178 (1), 23-32 (2004)
PUBMED 15550757
REFERENCE 7 (bases 1 to 738)
AUTHORS Dietrich,S., Schubert,F.R. and Gruss,P.
TITLE Altered Pax gene expression in murine notochord mutants: the
notochord is required to initiate and maintain ventral identity in
the somite
JOURNAL Mech Dev 44 (2-3), 189-207 (1993)
PUBMED 8155581
REFERENCE 8 (bases 1 to 738)
AUTHORS THEILER,K.
TITLE Anatomy and development of the 'truncate' (boneless) mutation in
the mouse
JOURNAL Am J Anat 104, 319-343 (1959)
PUBMED 13837681
COMMENT INFERRED REFSEQ: This record is predicted by genome sequence
analysis and is not yet supported by experimental evidence. The
reference sequence was derived from JAXUCZ010000004.1.
On Jul 17, 2010 this sequence version replaced XM_578357.1.
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
##Evidence-Data-START##
RNAseq introns :: single sample supports all introns SAMEA5760389,
SAMEA5760434 [ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on single protein-coding transcript
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-379 JAXUCZ010000004.1 119518663-119519041
380-591 JAXUCZ010000004.1 119520022-119520233
592-738 JAXUCZ010000004.1 119522756-119522902
FEATURES Location/Qualifiers
source 1..738
/organism="Rattus norvegicus"
/mol_type="mRNA"
/strain="BN"
/db_xref="taxon:10116"
/chromosome="4"
/map="4q34"
gene 1..738
/gene="Noto"
/gene_synonym="RGD1562910"
/note="notochord homeobox"
/db_xref="GeneID:502857"
/db_xref="RGD:1562910"
CDS 1..738
/gene="Noto"
/gene_synonym="RGD1562910"
/note="notochord homolog"
/codon_start=1
/product="homeobox protein notochord"
/protein_id="NP_001178943.1"
/db_xref="GeneID:502857"
/db_xref="RGD:1562910"
/translation="
MSSPVPQPASSGTQVQPGDLGPCPVAVSPVVPNHLARGRLESSFSVEAILARPETREHSATSLPLSTCTSLNFGSVSQYQVLPWVCSTGTWLPTYLSVGIYPMCSMSCMPGLNVTHLFCQQGLRLTGSELPSCLGPLKRAPTVNLQDHNTERHQKRVRTMFSEQQLGELEKVFAKQHNLVGKERAQLAARLHLTENQVRIWFQNRRVKYQKQQKLKSPPPDAMEEPSNSSEGNVRNEDAEAGVGS"
misc_feature 463..633
/gene="Noto"
/gene_synonym="RGD1562910"
/note="Region: Homeodomain; pfam00046"
/db_xref="CDD:459649"
exon 1..379
/gene="Noto"
/gene_synonym="RGD1562910"
/inference="alignment:Splign:2.1.0"
exon 380..591
/gene="Noto"
/gene_synonym="RGD1562910"
/inference="alignment:Splign:2.1.0"
exon 592..738
/gene="Noto"
/gene_synonym="RGD1562910"
/inference="alignment:Splign:2.1.0"
ORIGIN
atgtccagcccagtgccccagcctgcttcctcaggcactcaggtccagcccggggacttgggaccctgtccggtggctgtttccccagtagtcccgaaccacctagctcggggacgcctggagtcctccttctctgttgaggccatcctggcgagacccgagactcgtgagcactctgccacgtctctgccgctctctacctgcaccagtctgaactttggctctgtgtcacagtaccaggtcctgccctgggtgtgctccacggggacttggctgcccacctacctgagcgtaggcatctacccgatgtgctccatgtcctgcatgcccggattgaatgtgactcacctcttctgccaacagggcctcagactcacagggtcagagctaccttcctgtctaggccctctgaaacgggcacccactgtgaaccttcaggaccacaataccgagagacaccaaaagagggttcgcacaatgtttagcgagcagcagctgggagagttggagaaggtatttgcaaagcagcacaacctggtggggaaggagagagcccagttggctgccaggctgcacttgacagagaaccaggtaaggatctggttccagaatcgcagggtaaagtatcaaaagcagcaaaaactgaagtcacctccccctgatgccatggaggagccctccaacagctcagagggcaacgtccggaatgaagacgctgaggcaggagttggcagttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]