GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-08 04:48:06, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_001134686            2500 bp    mRNA    linear   ROD 22-MAR-2023
DEFINITION  Rattus norvegicus solute carrier family 7 member 2 (Slc7a2),
            transcript variant 2, mRNA.
ACCESSION   NM_001134686
VERSION     NM_001134686.2
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 2500)
  AUTHORS   Hultstrom M, Helle F and Iversen BM.
  TITLE     AT(1) receptor activation regulates the mRNA expression of CAT1,
            CAT2, arginase-1, and DDAH2 in preglomerular vessels from
            angiotensin II hypertensive rats
  JOURNAL   Am J Physiol Renal Physiol 297 (1), F163-F168 (2009)
   PUBMED   19386725
  REMARK    GeneRIF: CAT1, CAT2, DDAH2, and arginase-1 expression in renal
            resistance vessels is regulated through the AT(1) receptor.
REFERENCE   2  (bases 1 to 2500)
  AUTHORS   Huang TY, Tsai PS and Huang CJ.
  TITLE     HO-1 overexpression attenuates endotoxin effects on CAT-2 isozymes
            expression
  JOURNAL   J Surg Res 148 (2), 172-180 (2008)
   PUBMED   18028947
  REMARK    GeneRIF: HO-1 overexpression significantly attenuates
            endotoxin-induced increases in nitric oxide and l-arginine
            transport, as well as the expression of iNOS and CAT-2 isozymes in
            septic rats.
REFERENCE   3  (bases 1 to 2500)
  AUTHORS   Schwartz IF, Chernichovsky T, Hagin D, Ingbir M, Reshef R, Chernin
            G, Levo Y and Schwartz D.
  TITLE     Differential regulation of L-arginine transporters (cationic amino
            acid transporter-1 and -2) by peroxynitrite in rat mesangial cells
  JOURNAL   Nephrol Dial Transplant 21 (12), 3409-3414 (2006)
   PUBMED   16998217
REFERENCE   4  (bases 1 to 2500)
  AUTHORS   Rothenberg ME, Doepker MP, Lewkowich IP, Chiaramonte MG, Stringer
            KF, Finkelman FD, MacLeod CL, Ellies LG and Zimmermann N.
  TITLE     Cationic amino acid transporter 2 regulates inflammatory
            homeostasis in the lung
  JOURNAL   Proc Natl Acad Sci U S A 103 (40), 14895-14900 (2006)
   PUBMED   17003120
REFERENCE   5  (bases 1 to 2500)
  AUTHORS   Yeramian A, Martin L, Arpa L, Bertran J, Soler C, McLeod C,
            Modolell M, Palacin M, Lloberas J and Celada A.
  TITLE     Macrophages require distinct arginine catabolism and transport
            systems for proliferation and for activation
  JOURNAL   Eur J Immunol 36 (6), 1516-1526 (2006)
   PUBMED   16703566
REFERENCE   6  (bases 1 to 2500)
  AUTHORS   Stevens BR, Kakuda DK, Yu K, Waters M, Vo CB and Raizada MK.
  TITLE     Induced nitric oxide synthesis is dependent on induced
            alternatively spliced CAT-2 encoding L-arginine transport in brain
            astrocytes
  JOURNAL   J Biol Chem 271 (39), 24017-24022 (1996)
   PUBMED   8798637
REFERENCE   7  (bases 1 to 2500)
  AUTHORS   Gill DJ, Low BC and Grigor MR.
  TITLE     Interleukin-1 beta and tumor necrosis factor-alpha stimulate the
            cat-2 gene of the L-arginine transporter in cultured vascular
            smooth muscle cells
  JOURNAL   J Biol Chem 271 (19), 11280-11283 (1996)
   PUBMED   8626679
REFERENCE   8  (bases 1 to 2500)
  AUTHORS   Kavanaugh MP, Wang H, Zhang Z, Zhang W, Wu YN, Dechant E, North RA
            and Kabat D.
  TITLE     Control of cationic amino acid transport and retroviral receptor
            functions in a membrane protein family
  JOURNAL   J Biol Chem 269 (22), 15445-15450 (1994)
   PUBMED   8195186
REFERENCE   9  (bases 1 to 2500)
  AUTHORS   Kudo H, Hirayoshi K, Kitagawa Y, Imamura S and Nagata K.
  TITLE     Two collagen-binding proteins, osteonectin and HSP47, are
            coordinately induced in transformed keratinocytes by heat and other
            stresses
  JOURNAL   Exp Cell Res 212 (2), 219-224 (1994)
   PUBMED   8187816
REFERENCE   10 (bases 1 to 2500)
  AUTHORS   Closs EI, Albritton LM, Kim JW and Cunningham JM.
  TITLE     Identification of a low affinity, high capacity transporter of
            cationic amino acids in mouse liver
  JOURNAL   J Biol Chem 268 (10), 7538-7544 (1993)
   PUBMED   8385111
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF245002.1.
            
            On Aug 31, 2012 this sequence version replaced NM_001134686.1.
            
            Transcript Variant: This variant (2) uses an alternate in-frame
            exon in the coding region compared to variant 1. The resulting
            protein (isoform b) is longer but has the same N- and C-termini
            compared to isoform a.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF245002.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           SAMD00132261, SAMD00132262
                                           [ECO:0000350]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression,
                                      longest protein
            ##RefSeq-Attributes-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2500              AF245002.1         2-2501
FEATURES             Location/Qualifiers
     source          1..2500
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="W"
                     /db_xref="taxon:10116"
                     /chromosome="16"
                     /map="16q12.1"
     gene            1..2500
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /note="solute carrier family 7 member 2"
                     /db_xref="GeneID:64554"
                     /db_xref="RGD:68387"
     exon            1..164
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            165..555
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     CDS             180..2156
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /note="isoform b is encoded by transcript variant 2; low
                     affinity cationic amino acid transporter 2; CAT-2;
                     cationic amino acid transporter-2A; solute carrier family
                     7 (cationic amino acid transporter, y+ system), member 2"
                     /codon_start=1
                     /product="cationic amino acid transporter 2 isoform b"
                     /protein_id="NP_001128158.1"
                     /db_xref="GeneID:64554"
                     /db_xref="RGD:68387"
                     /translation="
MIPCRAVLTFTRCLIRRKIVTLDSLEDSKLCRCLTTMDLIALGVGSTLGAGVYVLAGEVAKADSGPSIVVSFLIAALASVMAGLCYAEFGARVPKTGSAYLYTYVTVGELWAFITGWNLILSYVIGTSSVARAWSGTFDELLNKQIGQFFKTYFKMNYTGLAEYPDFFAVCLVLLLAGLLSFGVKESAWVNKFFTAINILVLLFVMVAGFVKGNVANWKISEEFLKNISASAREPPSENGTSIYGAGGFMPYGFTGTLAGAATCFYAFVGFDCIATTGEEVRNPQKAIPIGIVTSLLVCFMAYFGVSAALTLMMPYYLLDEKSPLPVAFEYVGWGPAKYVVAAGSLCALSTSLLGSIFPMPRVIYAMAEDGLLFKCLAQINSKTKTPIIATLSSGAVAAVMAFLFDLKALVDMMSIGTLMAYSLVAACVLILRYQPGLCYEQPKYTPEKDILESCTNATSKSESQVTMLQGQGFSLRTLFNPSALPTRQSASLVSFLVGFLAFLIAGLSILTTYGVQAIARLEAWSLALLALFLVLCAAVILTIWRQPQNQQKVAFMVPFLPFLPAFSILVNIYLMVQLSADTWVRFSIWMVLGFLIYFAYGIRHSLEGNPRDEEEDEDVCPDNVNAAAEEKSAMQANDHHQRNLSLPFILHEKTSEC"
     misc_feature    192..2003
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /note="cationic amino acid transport permease; Region:
                     2A0303; TIGR00906"
                     /db_xref="CDD:273330"
     exon            556..711
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            712..877
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            878..1011
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1012..1234
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1235..1374
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1375..1477
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1478..1683
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1684..1850
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1851..1959
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
     exon            1960..2500
                     /gene="Slc7a2"
                     /gene_synonym="Cat2; Cat2a; Cat2b"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gtgcccagcccgccttctgcagctcggcggcgggagcttctgtctgcgcggacctggaagacggcggcagctcgtctagccttcgagagcttgggaaccgcagagcgctgcagccggtcgtccgctggtgcccgtctccgtcgcgcagccagggcactgccccagttgctcccttcaccatgattccctgcagagcagtgctgactttcacacgatgtctgatccggagaaaaattgtcacactggacagtctggaagattccaaactctgccgctgcttaaccaccatggacctcatcgccctgggagttggaagcactctcggcgctggggtttacgtcctggctggagaagtcgccaaagctgactccggccctagtattgtggtgtctttcctcatcgctgccctggcttcggtgatggccggcctttgctacgctgaatttggggcccgagtaccaaagactggatctgcgtatctatacacatacgtcacggttggagagctgtgggccttcatcactggttggaatctcattctgtcatatgtcataggtacgtccagtgtcgcaagagcttggagtggcaccttcgatgagcttcttaacaaacagattggccagtttttcaagacctacttcaaaatgaattacaccggtctggcggagtatccggacttctttgccgtgtgccttgtattacttctggcaggtcttttatcttttggagtaaaggagtctgcttgggtgaataaattttttacagctattaatatcctggtccttctctttgtcatggtggctgggtttgtgaaaggaaatgtggctaactggaagatcagtgaagaatttctcaagaatatatcagcaagtgccagagaaccaccttctgaaaatggaacaagcatctacggggctggcggcttcatgccttatggctttacagggacgctggctggtgctgcaacgtgcttttatgcctttgtgggctttgactgcattgcaacaaccggcgaagaggtccggaatccccaaaaggctattcccattggaatagtaacttccttacttgtttgctttatggcctattttggggtttctgcagctttaacacttatgatgccttactacctcctggatgagaaaagcccactccctgttgcatttgaatatgtcggatggggtcctgctaaatacgttgtcgccgcaggctccctctgcgccttatcaacaagtcttcttggatccattttcccaatgcctcgtgtaatctatgctatggcggaggatgggttgcttttcaaatgtctagctcaaatcaattccaaaacgaagacaccaataattgctactttgtcatcgggtgcagtggcagctgtgatggcctttctttttgacctgaaggctctcgtggacatgatgtctattggcaccctcatggcctactctctggtcgcagcctgtgtgctcattctcaggtaccaacctggcttgtgttatgagcagcccaaatacacccctgagaaagacattctggagtcatgtaccaatgcgacctcgaagagcgagtcccaggtcaccatgctgcaaggacagggtttcagcctacgaaccctcttcaacccctctgctctgcccacacgacagtcagcctccctcgtgagcttcctggtgggattcctggctttcctcatcgccggcttgagtattctgaccacgtacggagtccaggccatcgccagactggaagcctggagcctggctcttctcgccctgttccttgtcctctgcgctgccgtcatcctgaccatttggaggcagccacagaatcagcaaaaagtagccttcatggtcccgttcttaccgtttctgccggccttcagcatcctggtcaacatttacttgatggtccagttaagcgcggacacttgggtcagattcagcatctggatggtgcttggctttctgatttacttcgcctatggcattagacacagcttggagggtaaccccagggatgaagaagaagatgaagatgtctgtccagacaacgtcaatgcagcagcagaagaaaagtctgccatgcaggcaaatgaccatcaccaaagaaacctcagcttgcctttcatacttcatgaaaagacaagtgaatgttgatgccggtccgcagccctaccacacatgccttaacaatgagtactttacggcaggaagccaccatcgtgctgggttgtcatgggtttgctgcagccacggtttgcctaacttatacttcctcctccggacagcttcttttcaaatggtggattatgtgtttggggagactgcctgagagcactcctcagtgatacgtatccccaaaacagtatgtctgtgtgggtacatgtgtgcttgggaatgtgagtgttcaatgttgttggttcttactctgtgacatgattccagtgcagtaactggtggcatgtactgcacatgctagtaaacagtatattgctgaatag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]