2024-05-08 16:36:17, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001134686 2500 bp mRNA linear ROD 22-MAR-2023 DEFINITION Rattus norvegicus solute carrier family 7 member 2 (Slc7a2), transcript variant 2, mRNA. ACCESSION NM_001134686 VERSION NM_001134686.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 2500) AUTHORS Hultstrom M, Helle F and Iversen BM. TITLE AT(1) receptor activation regulates the mRNA expression of CAT1, CAT2, arginase-1, and DDAH2 in preglomerular vessels from angiotensin II hypertensive rats JOURNAL Am J Physiol Renal Physiol 297 (1), F163-F168 (2009) PUBMED 19386725 REMARK GeneRIF: CAT1, CAT2, DDAH2, and arginase-1 expression in renal resistance vessels is regulated through the AT(1) receptor. REFERENCE 2 (bases 1 to 2500) AUTHORS Huang TY, Tsai PS and Huang CJ. TITLE HO-1 overexpression attenuates endotoxin effects on CAT-2 isozymes expression JOURNAL J Surg Res 148 (2), 172-180 (2008) PUBMED 18028947 REMARK GeneRIF: HO-1 overexpression significantly attenuates endotoxin-induced increases in nitric oxide and l-arginine transport, as well as the expression of iNOS and CAT-2 isozymes in septic rats. REFERENCE 3 (bases 1 to 2500) AUTHORS Schwartz IF, Chernichovsky T, Hagin D, Ingbir M, Reshef R, Chernin G, Levo Y and Schwartz D. TITLE Differential regulation of L-arginine transporters (cationic amino acid transporter-1 and -2) by peroxynitrite in rat mesangial cells JOURNAL Nephrol Dial Transplant 21 (12), 3409-3414 (2006) PUBMED 16998217 REFERENCE 4 (bases 1 to 2500) AUTHORS Rothenberg ME, Doepker MP, Lewkowich IP, Chiaramonte MG, Stringer KF, Finkelman FD, MacLeod CL, Ellies LG and Zimmermann N. TITLE Cationic amino acid transporter 2 regulates inflammatory homeostasis in the lung JOURNAL Proc Natl Acad Sci U S A 103 (40), 14895-14900 (2006) PUBMED 17003120 REFERENCE 5 (bases 1 to 2500) AUTHORS Yeramian A, Martin L, Arpa L, Bertran J, Soler C, McLeod C, Modolell M, Palacin M, Lloberas J and Celada A. TITLE Macrophages require distinct arginine catabolism and transport systems for proliferation and for activation JOURNAL Eur J Immunol 36 (6), 1516-1526 (2006) PUBMED 16703566 REFERENCE 6 (bases 1 to 2500) AUTHORS Stevens BR, Kakuda DK, Yu K, Waters M, Vo CB and Raizada MK. TITLE Induced nitric oxide synthesis is dependent on induced alternatively spliced CAT-2 encoding L-arginine transport in brain astrocytes JOURNAL J Biol Chem 271 (39), 24017-24022 (1996) PUBMED 8798637 REFERENCE 7 (bases 1 to 2500) AUTHORS Gill DJ, Low BC and Grigor MR. TITLE Interleukin-1 beta and tumor necrosis factor-alpha stimulate the cat-2 gene of the L-arginine transporter in cultured vascular smooth muscle cells JOURNAL J Biol Chem 271 (19), 11280-11283 (1996) PUBMED 8626679 REFERENCE 8 (bases 1 to 2500) AUTHORS Kavanaugh MP, Wang H, Zhang Z, Zhang W, Wu YN, Dechant E, North RA and Kabat D. TITLE Control of cationic amino acid transport and retroviral receptor functions in a membrane protein family JOURNAL J Biol Chem 269 (22), 15445-15450 (1994) PUBMED 8195186 REFERENCE 9 (bases 1 to 2500) AUTHORS Kudo H, Hirayoshi K, Kitagawa Y, Imamura S and Nagata K. TITLE Two collagen-binding proteins, osteonectin and HSP47, are coordinately induced in transformed keratinocytes by heat and other stresses JOURNAL Exp Cell Res 212 (2), 219-224 (1994) PUBMED 8187816 REFERENCE 10 (bases 1 to 2500) AUTHORS Closs EI, Albritton LM, Kim JW and Cunningham JM. TITLE Identification of a low affinity, high capacity transporter of cationic amino acids in mouse liver JOURNAL J Biol Chem 268 (10), 7538-7544 (1993) PUBMED 8385111 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from AF245002.1. On Aug 31, 2012 this sequence version replaced NM_001134686.1. Transcript Variant: This variant (2) uses an alternate in-frame exon in the coding region compared to variant 1. The resulting protein (isoform b) is longer but has the same N- and C-termini compared to isoform a. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF245002.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support SAMD00132261, SAMD00132262 [ECO:0000350] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-2500 AF245002.1 2-2501 FEATURES Location/Qualifiers source 1..2500 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="W" /db_xref="taxon:10116" /chromosome="16" /map="16q12.1" gene 1..2500 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /note="solute carrier family 7 member 2" /db_xref="GeneID:64554" /db_xref="RGD:68387" exon 1..164 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 165..555 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" CDS 180..2156 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /note="isoform b is encoded by transcript variant 2; low affinity cationic amino acid transporter 2; CAT-2; cationic amino acid transporter-2A; solute carrier family 7 (cationic amino acid transporter, y+ system), member 2" /codon_start=1 /product="cationic amino acid transporter 2 isoform b" /protein_id="NP_001128158.1" /db_xref="GeneID:64554" /db_xref="RGD:68387" /translation="
MIPCRAVLTFTRCLIRRKIVTLDSLEDSKLCRCLTTMDLIALGVGSTLGAGVYVLAGEVAKADSGPSIVVSFLIAALASVMAGLCYAEFGARVPKTGSAYLYTYVTVGELWAFITGWNLILSYVIGTSSVARAWSGTFDELLNKQIGQFFKTYFKMNYTGLAEYPDFFAVCLVLLLAGLLSFGVKESAWVNKFFTAINILVLLFVMVAGFVKGNVANWKISEEFLKNISASAREPPSENGTSIYGAGGFMPYGFTGTLAGAATCFYAFVGFDCIATTGEEVRNPQKAIPIGIVTSLLVCFMAYFGVSAALTLMMPYYLLDEKSPLPVAFEYVGWGPAKYVVAAGSLCALSTSLLGSIFPMPRVIYAMAEDGLLFKCLAQINSKTKTPIIATLSSGAVAAVMAFLFDLKALVDMMSIGTLMAYSLVAACVLILRYQPGLCYEQPKYTPEKDILESCTNATSKSESQVTMLQGQGFSLRTLFNPSALPTRQSASLVSFLVGFLAFLIAGLSILTTYGVQAIARLEAWSLALLALFLVLCAAVILTIWRQPQNQQKVAFMVPFLPFLPAFSILVNIYLMVQLSADTWVRFSIWMVLGFLIYFAYGIRHSLEGNPRDEEEDEDVCPDNVNAAAEEKSAMQANDHHQRNLSLPFILHEKTSEC"
misc_feature 192..2003 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /note="cationic amino acid transport permease; Region: 2A0303; TIGR00906" /db_xref="CDD:273330" exon 556..711 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 712..877 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 878..1011 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1012..1234 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1235..1374 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1375..1477 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1478..1683 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1684..1850 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1851..1959 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" exon 1960..2500 /gene="Slc7a2" /gene_synonym="Cat2; Cat2a; Cat2b" /inference="alignment:Splign:2.1.0" ORIGIN
gtgcccagcccgccttctgcagctcggcggcgggagcttctgtctgcgcggacctggaagacggcggcagctcgtctagccttcgagagcttgggaaccgcagagcgctgcagccggtcgtccgctggtgcccgtctccgtcgcgcagccagggcactgccccagttgctcccttcaccatgattccctgcagagcagtgctgactttcacacgatgtctgatccggagaaaaattgtcacactggacagtctggaagattccaaactctgccgctgcttaaccaccatggacctcatcgccctgggagttggaagcactctcggcgctggggtttacgtcctggctggagaagtcgccaaagctgactccggccctagtattgtggtgtctttcctcatcgctgccctggcttcggtgatggccggcctttgctacgctgaatttggggcccgagtaccaaagactggatctgcgtatctatacacatacgtcacggttggagagctgtgggccttcatcactggttggaatctcattctgtcatatgtcataggtacgtccagtgtcgcaagagcttggagtggcaccttcgatgagcttcttaacaaacagattggccagtttttcaagacctacttcaaaatgaattacaccggtctggcggagtatccggacttctttgccgtgtgccttgtattacttctggcaggtcttttatcttttggagtaaaggagtctgcttgggtgaataaattttttacagctattaatatcctggtccttctctttgtcatggtggctgggtttgtgaaaggaaatgtggctaactggaagatcagtgaagaatttctcaagaatatatcagcaagtgccagagaaccaccttctgaaaatggaacaagcatctacggggctggcggcttcatgccttatggctttacagggacgctggctggtgctgcaacgtgcttttatgcctttgtgggctttgactgcattgcaacaaccggcgaagaggtccggaatccccaaaaggctattcccattggaatagtaacttccttacttgtttgctttatggcctattttggggtttctgcagctttaacacttatgatgccttactacctcctggatgagaaaagcccactccctgttgcatttgaatatgtcggatggggtcctgctaaatacgttgtcgccgcaggctccctctgcgccttatcaacaagtcttcttggatccattttcccaatgcctcgtgtaatctatgctatggcggaggatgggttgcttttcaaatgtctagctcaaatcaattccaaaacgaagacaccaataattgctactttgtcatcgggtgcagtggcagctgtgatggcctttctttttgacctgaaggctctcgtggacatgatgtctattggcaccctcatggcctactctctggtcgcagcctgtgtgctcattctcaggtaccaacctggcttgtgttatgagcagcccaaatacacccctgagaaagacattctggagtcatgtaccaatgcgacctcgaagagcgagtcccaggtcaccatgctgcaaggacagggtttcagcctacgaaccctcttcaacccctctgctctgcccacacgacagtcagcctccctcgtgagcttcctggtgggattcctggctttcctcatcgccggcttgagtattctgaccacgtacggagtccaggccatcgccagactggaagcctggagcctggctcttctcgccctgttccttgtcctctgcgctgccgtcatcctgaccatttggaggcagccacagaatcagcaaaaagtagccttcatggtcccgttcttaccgtttctgccggccttcagcatcctggtcaacatttacttgatggtccagttaagcgcggacacttgggtcagattcagcatctggatggtgcttggctttctgatttacttcgcctatggcattagacacagcttggagggtaaccccagggatgaagaagaagatgaagatgtctgtccagacaacgtcaatgcagcagcagaagaaaagtctgccatgcaggcaaatgaccatcaccaaagaaacctcagcttgcctttcatacttcatgaaaagacaagtgaatgttgatgccggtccgcagccctaccacacatgccttaacaatgagtactttacggcaggaagccaccatcgtgctgggttgtcatgggtttgctgcagccacggtttgcctaacttatacttcctcctccggacagcttcttttcaaatggtggattatgtgtttggggagactgcctgagagcactcctcagtgatacgtatccccaaaacagtatgtctgtgtgggtacatgtgtgcttgggaatgtgagtgttcaatgttgttggttcttactctgtgacatgattccagtgcagtaactggtggcatgtactgcacatgctagtaaacagtatattgctgaatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]