LOCUS       NM_001109557             684 bp    mRNA    linear   ROD 23-MAR-2023
DEFINITION  Rattus norvegicus crystallin, gamma F (Crygf), mRNA.
ACCESSION   NM_001109557 NM_001085380 XM_001072649
VERSION     NM_001109557.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 684)
  AUTHORS   Kim I, Saito T, Fujii N, Kanamoto T, Chatake T and Fujii N.
  TITLE     Site specific oxidation of amino acid residues in rat lens
            gamma-crystallin induced by low-dose gamma-irradiation
  JOURNAL   Biochem Biophys Res Commun 466 (4), 622-628 (2015)
   PUBMED   26385181
  REMARK    GeneRIF: Specific oxidation sites of methionine, cysteine and
            tryptophan in water-soluble and -insoluble gammaE and
            gammaF-crystallin were determined by one-shot analysis after
            low-dose gamma-irradiation.
REFERENCE   2  (bases 1 to 684)
  AUTHORS   Lengler J, Krausz E, Tomarev S, Prescott A, Quinlan RA and Graw J.
  TITLE     Antagonistic action of Six3 and Prox1 at the gamma-crystallin
            promoter
  JOURNAL   Nucleic Acids Res 29 (2), 515-526 (2001)
   PUBMED   11139622
REFERENCE   3  (bases 1 to 684)
  AUTHORS   Voorter CE, De Haard-Hoekman WA, Hermans MM, Bloemendal H and De
            Jong WW.
  TITLE     Differential synthesis of crystallins in the developing rat eye
            lens
  JOURNAL   Exp Eye Res 50 (4), 429-437 (1990)
   PUBMED   2338125
REFERENCE   4  (bases 1 to 684)
  AUTHORS   den Dunnen JT, van Neck JW, Cremers FP, Lubsen NH and Schoenmakers
            JG.
  TITLE     Nucleotide sequence of the rat gamma-crystallin gene region and
            comparison with an orthologous human region
  JOURNAL   Gene 78 (2), 201-213 (1989)
   PUBMED   2777080
REFERENCE   5  (bases 1 to 684)
  AUTHORS   den Dunnen,J.T., Moormann,R.J., Lubsen,N.H. and Schoenmakers,J.G.
  TITLE     Concerted and divergent evolution within the rat gamma-crystallin
            gene family
  JOURNAL   J Mol Biol 189 (1), 37-46 (1986)
   PUBMED   3783678
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH474044.2.
            
            On or before May 29, 2008 this sequence version replaced
            NM_001085380.1, XM_001072649.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BF553419.1 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on conservation, expression
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..684
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="9"
                     /map="9q32"
     gene            1..684
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /note="crystallin, gamma F"
                     /db_xref="GeneID:689947"
                     /db_xref="RGD:1586353"
     exon            1..104
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /inference="alignment:Splign:2.1.0"
     CDS             96..620
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /note="crystallin, gamma polypeptide 6;
                     gamma-F-crystallin; gamma-crystallin 4-1"
                     /codon_start=1
                     /product="gamma-crystallin F"
                     /protein_id="NP_001103027.1"
                     /db_xref="GeneID:689947"
                     /db_xref="RGD:1586353"
                     /translation="

MGKITFYEDRGFQGRHYECSTDHSNLQPYFSRCNSVRVDSGCWMLYEQPNFTGCQYFLRRGEYPDYQQWMGFSDSVRSCHLIPHSSSHRIRIYEREDYRGQMVEITDDCPHLQDRFHFSDFHSFHVIEGYWVLYEMPNYRGRQYLLRPREYRRYHDWGAMNARVGSLRRIMDYY"

     misc_feature    102..341
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /note="Beta/gamma crystallins; Region: XTALbg; smart00247"
                     /db_xref="CDD:214583"
     misc_feature    345..356
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /note="propagated from UniProtKB/Swiss-Prot (P10068.2);
                     Region: Connecting peptide"
     misc_feature    360..605
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /note="Beta/Gamma crystallin; Region: Crystall; pfam00030"
                     /db_xref="CDD:425430"
     exon            105..347
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /inference="alignment:Splign:2.1.0"
     exon            348..684
                     /gene="Crygf"
                     /gene_synonym="Cryg6; Len"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gttcctgccaacgcagcagacctcctgctatatatatagaccctgctcccagccctacacaaccaacagcaccatcccatccgcaaacaccagccatgggaaagatcaccttctatgaggaccgaggcttccagggccgccactatgagtgcagcacagaccactccaacctgcagccctacttcagccgctgcaactctgtgcgcgtggacagtggctgctggatgctctatgagcagcccaacttcacaggctgccagtatttccttcgtcgcggggagtaccctgactaccagcagtggatgggtttcagcgactctgtccgctcctgccacctcatcccccactccagctctcacagaatcaggatctacgagcgagaggactacagaggccagatggtggagatcacagacgactgcccccacctgcaggaccgcttccacttcagtgacttccactccttccacgtgatagagggctactgggtcctctacgagatgcccaactaccgggggcggcagtacctgctgaggcccagggaatacaggcgctaccacgactggggcgccatgaatgccagggtgggctctctgaggagaatcatggattactattgaattgtcttactctgccctttcatcatttggaagttaataaaatatttcctgtgtgttccatgca

//