2024-05-05 16:26:03, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001109557 684 bp mRNA linear ROD 23-MAR-2023 DEFINITION Rattus norvegicus crystallin, gamma F (Crygf), mRNA. ACCESSION NM_001109557 NM_001085380 XM_001072649 VERSION NM_001109557.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 684) AUTHORS Kim I, Saito T, Fujii N, Kanamoto T, Chatake T and Fujii N. TITLE Site specific oxidation of amino acid residues in rat lens gamma-crystallin induced by low-dose gamma-irradiation JOURNAL Biochem Biophys Res Commun 466 (4), 622-628 (2015) PUBMED 26385181 REMARK GeneRIF: Specific oxidation sites of methionine, cysteine and tryptophan in water-soluble and -insoluble gammaE and gammaF-crystallin were determined by one-shot analysis after low-dose gamma-irradiation. REFERENCE 2 (bases 1 to 684) AUTHORS Lengler J, Krausz E, Tomarev S, Prescott A, Quinlan RA and Graw J. TITLE Antagonistic action of Six3 and Prox1 at the gamma-crystallin promoter JOURNAL Nucleic Acids Res 29 (2), 515-526 (2001) PUBMED 11139622 REFERENCE 3 (bases 1 to 684) AUTHORS Voorter CE, De Haard-Hoekman WA, Hermans MM, Bloemendal H and De Jong WW. TITLE Differential synthesis of crystallins in the developing rat eye lens JOURNAL Exp Eye Res 50 (4), 429-437 (1990) PUBMED 2338125 REFERENCE 4 (bases 1 to 684) AUTHORS den Dunnen JT, van Neck JW, Cremers FP, Lubsen NH and Schoenmakers JG. TITLE Nucleotide sequence of the rat gamma-crystallin gene region and comparison with an orthologous human region JOURNAL Gene 78 (2), 201-213 (1989) PUBMED 2777080 REFERENCE 5 (bases 1 to 684) AUTHORS den Dunnen,J.T., Moormann,R.J., Lubsen,N.H. and Schoenmakers,J.G. TITLE Concerted and divergent evolution within the rat gamma-crystallin gene family JOURNAL J Mol Biol 189 (1), 37-46 (1986) PUBMED 3783678 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH474044.2. On or before May 29, 2008 this sequence version replaced NM_001085380.1, XM_001072649.1. ##Evidence-Data-START## Transcript exon combination :: BF553419.1 [ECO:0000332] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..684 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="9" /map="9q32" gene 1..684 /gene="Crygf" /gene_synonym="Cryg6; Len" /note="crystallin, gamma F" /db_xref="GeneID:689947" /db_xref="RGD:1586353" exon 1..104 /gene="Crygf" /gene_synonym="Cryg6; Len" /inference="alignment:Splign:2.1.0" CDS 96..620 /gene="Crygf" /gene_synonym="Cryg6; Len" /note="crystallin, gamma polypeptide 6; gamma-F-crystallin; gamma-crystallin 4-1" /codon_start=1 /product="gamma-crystallin F" /protein_id="NP_001103027.1" /db_xref="GeneID:689947" /db_xref="RGD:1586353" /translation="
MGKITFYEDRGFQGRHYECSTDHSNLQPYFSRCNSVRVDSGCWMLYEQPNFTGCQYFLRRGEYPDYQQWMGFSDSVRSCHLIPHSSSHRIRIYEREDYRGQMVEITDDCPHLQDRFHFSDFHSFHVIEGYWVLYEMPNYRGRQYLLRPREYRRYHDWGAMNARVGSLRRIMDYY"
misc_feature 102..341 /gene="Crygf" /gene_synonym="Cryg6; Len" /note="Beta/gamma crystallins; Region: XTALbg; smart00247" /db_xref="CDD:214583" misc_feature 345..356 /gene="Crygf" /gene_synonym="Cryg6; Len" /note="propagated from UniProtKB/Swiss-Prot (P10068.2); Region: Connecting peptide" misc_feature 360..605 /gene="Crygf" /gene_synonym="Cryg6; Len" /note="Beta/Gamma crystallin; Region: Crystall; pfam00030" /db_xref="CDD:425430" exon 105..347 /gene="Crygf" /gene_synonym="Cryg6; Len" /inference="alignment:Splign:2.1.0" exon 348..684 /gene="Crygf" /gene_synonym="Cryg6; Len" /inference="alignment:Splign:2.1.0" ORIGIN
gttcctgccaacgcagcagacctcctgctatatatatagaccctgctcccagccctacacaaccaacagcaccatcccatccgcaaacaccagccatgggaaagatcaccttctatgaggaccgaggcttccagggccgccactatgagtgcagcacagaccactccaacctgcagccctacttcagccgctgcaactctgtgcgcgtggacagtggctgctggatgctctatgagcagcccaacttcacaggctgccagtatttccttcgtcgcggggagtaccctgactaccagcagtggatgggtttcagcgactctgtccgctcctgccacctcatcccccactccagctctcacagaatcaggatctacgagcgagaggactacagaggccagatggtggagatcacagacgactgcccccacctgcaggaccgcttccacttcagtgacttccactccttccacgtgatagagggctactgggtcctctacgagatgcccaactaccgggggcggcagtacctgctgaggcccagggaatacaggcgctaccacgactggggcgccatgaatgccagggtgggctctctgaggagaatcatggattactattgaattgtcttactctgccctttcatcatttggaagttaataaaatatttcctgtgtgttccatgca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]