LOCUS       NM_001105743            1968 bp    mRNA    linear   ROD 20-MAR-2023
DEFINITION  Rattus norvegicus SHC adaptor protein 3 (Shc3), mRNA.
ACCESSION   NM_001105743 XM_001054242 XM_341498
VERSION     NM_001105743.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 1968)
  AUTHORS   Tang N, Lyu D, Liu T, Chen F, Jing S, Hao T and Liu S.
  TITLE     Different Effects of p52SHC1 and p52SHC3 on the Cell Cycle of
            Neurons and Neural Stem Cells
  JOURNAL   J Cell Physiol 231 (1), 172-180 (2016)
   PUBMED   26058566
  REMARK    GeneRIF: that p52SHC3 plays an important role in maintaining the
            mitotic quiescence of neurons, while p52SHC1 regulates the
            proliferation of neural stem cells
REFERENCE   2  (bases 1 to 1968)
  AUTHORS   Mehlitz A, Banhart S, Maurer AP, Kaushansky A, Gordus AG, Zielecki
            J, Macbeath G and Meyer TF.
  TITLE     Tarp regulates early Chlamydia-induced host cell survival through
            interactions with the human adaptor protein SHC1
  JOURNAL   J Cell Biol 190 (1), 143-157 (2010)
   PUBMED   20624904
REFERENCE   3  (bases 1 to 1968)
  AUTHORS   Magrassi L, Marziliano N, Inzani F, Cassini P, Chiaranda I, Skrap
            M, Pizzolito S, Arienta C and Arbustini E.
  TITLE     EDG3 and SHC3 on chromosome 9q22 are co-amplified in human
            ependymomas
  JOURNAL   Cancer Lett 290 (1), 36-42 (2010)
   PUBMED   19748727
REFERENCE   4  (bases 1 to 1968)
  AUTHORS   Miyamoto Y, Chen L, Sato M, Sokabe M, Nabeshima T, Pawson T, Sakai
            R and Mori N.
  TITLE     Hippocampal synaptic modulation by the phosphotyrosine adapter
            protein ShcC/N-Shc via interaction with the NMDA receptor
  JOURNAL   J Neurosci 25 (7), 1826-1835 (2005)
   PUBMED   15716419
REFERENCE   5  (bases 1 to 1968)
  AUTHORS   Jiang X, Edstrom E, Altun M and Ulfhake B.
  TITLE     Differential regulation of Shc adaptor proteins in skeletal muscle,
            spinal cord and forebrain of aged rats with sensorimotor impairment
  JOURNAL   Aging Cell 2 (1), 47-57 (2003)
   PUBMED   12882334
  REMARK    GeneRIF: data show that the regulation of Shc mRNAs in senescence
            is region as well as isoform specific
REFERENCE   6  (bases 1 to 1968)
  AUTHORS   Nakazawa T, Nakano I, Sato M, Nakamura T, Tamai M and Mori N.
  TITLE     Comparative expression profiles of Trk receptors and Shc-related
            phosphotyrosine adapters during retinal development: potential
            roles of N-Shc/ShcC in brain-derived neurotrophic factor signal
            transduction and modulation
  JOURNAL   J Neurosci Res 68 (6), 668-680 (2002)
   PUBMED   12111828
  REMARK    GeneRIF: ShcC could be a potential phosphotyrosine adapter among
            the Shc family members for BDNF signaling and function during
            retinal development.
REFERENCE   7  (bases 1 to 1968)
  AUTHORS   Cook KK and Fadool DA.
  TITLE     Two adaptor proteins differentially modulate the phosphorylation
            and biophysics of Kv1.3 ion channel by SRC kinase
  JOURNAL   J Biol Chem 277 (15), 13268-13280 (2002)
   PUBMED   11812778
  REMARK    GeneRIF: modulation of phosphorylation and biophysics by combined
            effect of src kinase, Grb10 and n-Shc adaptor proteins (Kv1.3)
REFERENCE   8  (bases 1 to 1968)
  AUTHORS   Nakamura T, Muraoka S, Sanokawa R and Mori N.
  TITLE     N-Shc and Sck, two neuronally expressed Shc adapter homologs. Their
            differential regional expression in the brain and roles in
            neurotrophin and Src signaling
  JOURNAL   J Biol Chem 273 (12), 6960-6967 (1998)
   PUBMED   9507002
REFERENCE   9  (bases 1 to 1968)
  AUTHORS   Basu T, Warne PH and Downward J.
  TITLE     Role of Shc in the activation of Ras in response to epidermal
            growth factor and nerve growth factor
  JOURNAL   Oncogene 9 (12), 3483-3491 (1994)
   PUBMED   7970708
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from CH473977.1.
            
            On or before Oct 3, 2007 this sequence version replaced
            XM_341498.3, XM_001054242.1.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMEA5760389,
                              SAMEA5760393 [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..1968
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10116"
                     /chromosome="17"
                     /map="17p14"
     gene            1..1968
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="SHC adaptor protein 3"
                     /db_xref="GeneID:114858"
                     /db_xref="RGD:69348"
     CDS             1..1785
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="N-Shc; neuronal Shc; SH2 domain protein C3; SHC
                     (Src homology 2 domain containing) transforming protein 3;
                     SHC-transforming protein C; src homology 2
                     domain-containing transforming protein C3"
                     /codon_start=1
                     /product="SHC-transforming protein 3"
                     /protein_id="NP_001099213.1"
                     /db_xref="GeneID:114858"
                     /db_xref="RGD:69348"
                     /translation="

MLPRTKYNRFRNDSVTSVDDLLHSLSVSGSGGKVSAEPAASPYLVSGEALRKAPDDGPGSLGHLLHKVSHLKLSSSGLRGLSSAARERAGARLSGSCSAPSLAAPDGGSATPGSRAPAASMSATRKSRASDEPLPRPPRGAPHASDQVLGSGVTYVVKYLGCIEVLRSMRSLDFSTRTQVTREAISRVCEAVPGAKGAFKKRKPPSKMLSSILGKSNLQFAGMSISLTISTASLNLRTPDSKQIIANHHMRSISFASGGDPDTTDYVAYVAKDPVNRRACHILECCDGLAQDVIGSIGQAFELRFKQYLQCPSKIPALQDRMQSLDEPWTEEEGDGPDHPYYNSVPNKMPPPGGFLDARLKARPHAPDAAQFSGKEQTYYQGRHLGDAFGEDWQRAPTRQGSLDIYSTPEGKAHMVPVGETPTYVNTQPVPPQVWPAATSSTESSPRKDLFDMKPFEDALRNQPLGPVLSKAASVECISPVTPRAPDAKMLEELNAEPWYQGEMSRKEAEALLQEDGDFLVRKSTTNPGSFVLTGMHNGQAKHLLLVDPEGTVRTKDRVFDSISHLITYHLESSLPIVSAGSELCLRQPVERKP"

     misc_feature    283..441
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="propagated from UniProtKB/Swiss-Prot (O70143.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    415..930
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="Shc-like phosphotyrosine-binding (PTB) domain;
                     Region: PTB_Shc; cd01209"
                     /db_xref="CDD:269920"
     misc_feature    order(505..516,529..531,754..780,814..816,832..834,
                     871..873,880..885,889..894,901..906,913..924,928..930)
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="phosphopeptide binding site [polypeptide binding];
                     other site"
                     /db_xref="CDD:269920"
     misc_feature    order(643..645,655..657,724..726)
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="phosphoinositide binding site [chemical binding];
                     other site"
                     /db_xref="CDD:269920"
     misc_feature    1003..1494
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="propagated from UniProtKB/Swiss-Prot (O70143.1);
                     Region: CH1"
     misc_feature    1204..1206
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:Q61120; propagated from
                     UniProtKB/Swiss-Prot (O70143.1); phosphorylation site"
     misc_feature    1282..1341
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="propagated from UniProtKB/Swiss-Prot (O70143.1);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    1474..1782
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="Src homology 2 (SH2) domain found in SH2 adaptor
                     protein C (SHC); Region: SH2_SHC; cd09925"
                     /db_xref="CDD:198179"
     misc_feature    order(1516..1518,1564..1566,1570..1572,1585..1587,
                     1600..1602,1627..1635)
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="phosphotyrosine binding pocket [polypeptide
                     binding]; other site"
                     /db_xref="CDD:198179"
     misc_feature    order(1597..1599,1630..1632,1636..1638,1642..1644,
                     1657..1665,1678..1680,1696..1698,1729..1737)
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /note="hydrophobic binding pocket [polypeptide binding];
                     other site"
                     /db_xref="CDD:198179"
     exon            1..474
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            475..545
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            546..609
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            610..729
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            730..783
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            784..835
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            836..962
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            963..1113
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            1114..1201
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            1202..1360
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            1361..1656
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
     exon            1657..1968
                     /gene="Shc3"
                     /gene_synonym="ShcC"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgcttccacgcaccaagtacaaccgcttcaggaatgactcggtgacatcggtcgatgaccttctccacagcctgtcggtgagcggcagcggcggcaaggtctcggcggagcccgcggcgagcccctacctggtgtcgggcgaggcgctgcgcaaggcgccggacgatgggcccggcagcctgggccacctgctccacaaggtgtcccacttgaaactctccagctccggcctgcgtggcctgtcgtcggccgcccgggagcgggcaggagcgcggctctcgggcagctgcagcgcgcccagcctggcggccccggacggtggcagcgcgacccccgggtcccgtgccccggccgccagcatgagcgccaccaggaagagccgggccagcgacgagccgttgcccaggcccccgcggggcgcgccgcacgccagcgaccaggtgctggggtcgggagtcacctatgtggtcaagtacttgggatgcatcgaagttctgcgctcaatgaggtctcttgacttcagtacaagaactcaggttaccagggaagccatcagccgtgtctgcgaagctgtgccaggcgccaaaggagccttcaagaagagaaagcctccgagtaaaatgctgtccagcatcctggggaagagcaacctccagttcgcagggatgagcatctccctgaccatctccaccgccagcctgaacctgcgcactcctgactccaaacagatcatagcgaaccatcacatgcggtccatctccttcgcctcagggggagacccggacacaacagactatgttgcctacgtcgctaaggaccctgtgaatcgcagagcttgccacattctggaatgctgtgacgggctagcccaagatgtcatcggctccatcggacaagcctttgaactccggttcaagcagtatttgcagtgtccttccaagattcctgctctccaggaccgaatgcagagtctggacgagccgtggactgaagaagagggagatggccccgatcacccgtactacaacagcgttcccaacaagatgcctcctccaggagggtttctcgatgctcgattgaaagccagaccccacgctcctgatgcagcccagttttcaggaaaagagcaaacttattaccagggaagacacttaggagatgcattcggtgaagactggcagagagcacccaccaggcaaggctccttggacatctatagcacaccagaagggaaagctcacatggttcctgtaggagaaacaccaacctatgtcaacacccagccagtcccaccacaggtttggccagcagcaaccagcagcactgagagcagcccacggaaggacctctttgacatgaagccttttgaagatgccctcagaaaccaacccctgggccctgtgttgagcaaagctgcgtctgtggagtgtatcagccccgttacacccagagccccggacgccaagatgctggaggagcttaatgctgagccctggtaccaaggcgagatgagcaggaaggaggcagaggctctactacaggaagatggagacttcctagtcaggaagagtaccaccaaccccggctcctttgtcctcacaggcatgcacaatggccaggccaagcacctgctgctggtggacccggaaggcacggtccggacgaaggacagggtctttgacagcatcagtcacctcattacttaccacctggagagcagcctgcccattgtctctgccgggagtgagctttgtctccggcaaccagtggagaggaaaccctgagcttgccctgcgcccaggtcaggaggacctgggctccgctgctcttagcctatggaatctggggcaactgtctgtgggcccatcaccttcttcaaaagccccgtgagagaggtttccttcaaattcaaatttcataaatatgttcacatgactcagatgcatagtagaaatgtatatacccac

//