2024-05-03 03:06:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001105743 1968 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus SHC adaptor protein 3 (Shc3), mRNA. ACCESSION NM_001105743 XM_001054242 XM_341498 VERSION NM_001105743.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1968) AUTHORS Tang N, Lyu D, Liu T, Chen F, Jing S, Hao T and Liu S. TITLE Different Effects of p52SHC1 and p52SHC3 on the Cell Cycle of Neurons and Neural Stem Cells JOURNAL J Cell Physiol 231 (1), 172-180 (2016) PUBMED 26058566 REMARK GeneRIF: that p52SHC3 plays an important role in maintaining the mitotic quiescence of neurons, while p52SHC1 regulates the proliferation of neural stem cells REFERENCE 2 (bases 1 to 1968) AUTHORS Mehlitz A, Banhart S, Maurer AP, Kaushansky A, Gordus AG, Zielecki J, Macbeath G and Meyer TF. TITLE Tarp regulates early Chlamydia-induced host cell survival through interactions with the human adaptor protein SHC1 JOURNAL J Cell Biol 190 (1), 143-157 (2010) PUBMED 20624904 REFERENCE 3 (bases 1 to 1968) AUTHORS Magrassi L, Marziliano N, Inzani F, Cassini P, Chiaranda I, Skrap M, Pizzolito S, Arienta C and Arbustini E. TITLE EDG3 and SHC3 on chromosome 9q22 are co-amplified in human ependymomas JOURNAL Cancer Lett 290 (1), 36-42 (2010) PUBMED 19748727 REFERENCE 4 (bases 1 to 1968) AUTHORS Miyamoto Y, Chen L, Sato M, Sokabe M, Nabeshima T, Pawson T, Sakai R and Mori N. TITLE Hippocampal synaptic modulation by the phosphotyrosine adapter protein ShcC/N-Shc via interaction with the NMDA receptor JOURNAL J Neurosci 25 (7), 1826-1835 (2005) PUBMED 15716419 REFERENCE 5 (bases 1 to 1968) AUTHORS Jiang X, Edstrom E, Altun M and Ulfhake B. TITLE Differential regulation of Shc adaptor proteins in skeletal muscle, spinal cord and forebrain of aged rats with sensorimotor impairment JOURNAL Aging Cell 2 (1), 47-57 (2003) PUBMED 12882334 REMARK GeneRIF: data show that the regulation of Shc mRNAs in senescence is region as well as isoform specific REFERENCE 6 (bases 1 to 1968) AUTHORS Nakazawa T, Nakano I, Sato M, Nakamura T, Tamai M and Mori N. TITLE Comparative expression profiles of Trk receptors and Shc-related phosphotyrosine adapters during retinal development: potential roles of N-Shc/ShcC in brain-derived neurotrophic factor signal transduction and modulation JOURNAL J Neurosci Res 68 (6), 668-680 (2002) PUBMED 12111828 REMARK GeneRIF: ShcC could be a potential phosphotyrosine adapter among the Shc family members for BDNF signaling and function during retinal development. REFERENCE 7 (bases 1 to 1968) AUTHORS Cook KK and Fadool DA. TITLE Two adaptor proteins differentially modulate the phosphorylation and biophysics of Kv1.3 ion channel by SRC kinase JOURNAL J Biol Chem 277 (15), 13268-13280 (2002) PUBMED 11812778 REMARK GeneRIF: modulation of phosphorylation and biophysics by combined effect of src kinase, Grb10 and n-Shc adaptor proteins (Kv1.3) REFERENCE 8 (bases 1 to 1968) AUTHORS Nakamura T, Muraoka S, Sanokawa R and Mori N. TITLE N-Shc and Sck, two neuronally expressed Shc adapter homologs. Their differential regional expression in the brain and roles in neurotrophin and Src signaling JOURNAL J Biol Chem 273 (12), 6960-6967 (1998) PUBMED 9507002 REFERENCE 9 (bases 1 to 1968) AUTHORS Basu T, Warne PH and Downward J. TITLE Role of Shc in the activation of Ras in response to epidermal growth factor and nerve growth factor JOURNAL Oncogene 9 (12), 3483-3491 (1994) PUBMED 7970708 COMMENT PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence was derived from CH473977.1. On or before Oct 3, 2007 this sequence version replaced XM_341498.3, XM_001054242.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMEA5760389, SAMEA5760393 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## FEATURES Location/Qualifiers source 1..1968 /organism="Rattus norvegicus" /mol_type="mRNA" /db_xref="taxon:10116" /chromosome="17" /map="17p14" gene 1..1968 /gene="Shc3" /gene_synonym="ShcC" /note="SHC adaptor protein 3" /db_xref="GeneID:114858" /db_xref="RGD:69348" CDS 1..1785 /gene="Shc3" /gene_synonym="ShcC" /note="N-Shc; neuronal Shc; SH2 domain protein C3; SHC (Src homology 2 domain containing) transforming protein 3; SHC-transforming protein C; src homology 2 domain-containing transforming protein C3" /codon_start=1 /product="SHC-transforming protein 3" /protein_id="NP_001099213.1" /db_xref="GeneID:114858" /db_xref="RGD:69348" /translation="
MLPRTKYNRFRNDSVTSVDDLLHSLSVSGSGGKVSAEPAASPYLVSGEALRKAPDDGPGSLGHLLHKVSHLKLSSSGLRGLSSAARERAGARLSGSCSAPSLAAPDGGSATPGSRAPAASMSATRKSRASDEPLPRPPRGAPHASDQVLGSGVTYVVKYLGCIEVLRSMRSLDFSTRTQVTREAISRVCEAVPGAKGAFKKRKPPSKMLSSILGKSNLQFAGMSISLTISTASLNLRTPDSKQIIANHHMRSISFASGGDPDTTDYVAYVAKDPVNRRACHILECCDGLAQDVIGSIGQAFELRFKQYLQCPSKIPALQDRMQSLDEPWTEEEGDGPDHPYYNSVPNKMPPPGGFLDARLKARPHAPDAAQFSGKEQTYYQGRHLGDAFGEDWQRAPTRQGSLDIYSTPEGKAHMVPVGETPTYVNTQPVPPQVWPAATSSTESSPRKDLFDMKPFEDALRNQPLGPVLSKAASVECISPVTPRAPDAKMLEELNAEPWYQGEMSRKEAEALLQEDGDFLVRKSTTNPGSFVLTGMHNGQAKHLLLVDPEGTVRTKDRVFDSISHLITYHLESSLPIVSAGSELCLRQPVERKP"
misc_feature 283..441 /gene="Shc3" /gene_synonym="ShcC" /note="propagated from UniProtKB/Swiss-Prot (O70143.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 415..930 /gene="Shc3" /gene_synonym="ShcC" /note="Shc-like phosphotyrosine-binding (PTB) domain; Region: PTB_Shc; cd01209" /db_xref="CDD:269920" misc_feature order(505..516,529..531,754..780,814..816,832..834, 871..873,880..885,889..894,901..906,913..924,928..930) /gene="Shc3" /gene_synonym="ShcC" /note="phosphopeptide binding site [polypeptide binding]; other site" /db_xref="CDD:269920" misc_feature order(643..645,655..657,724..726) /gene="Shc3" /gene_synonym="ShcC" /note="phosphoinositide binding site [chemical binding]; other site" /db_xref="CDD:269920" misc_feature 1003..1494 /gene="Shc3" /gene_synonym="ShcC" /note="propagated from UniProtKB/Swiss-Prot (O70143.1); Region: CH1" misc_feature 1204..1206 /gene="Shc3" /gene_synonym="ShcC" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:Q61120; propagated from UniProtKB/Swiss-Prot (O70143.1); phosphorylation site" misc_feature 1282..1341 /gene="Shc3" /gene_synonym="ShcC" /note="propagated from UniProtKB/Swiss-Prot (O70143.1); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 1474..1782 /gene="Shc3" /gene_synonym="ShcC" /note="Src homology 2 (SH2) domain found in SH2 adaptor protein C (SHC); Region: SH2_SHC; cd09925" /db_xref="CDD:198179" misc_feature order(1516..1518,1564..1566,1570..1572,1585..1587, 1600..1602,1627..1635) /gene="Shc3" /gene_synonym="ShcC" /note="phosphotyrosine binding pocket [polypeptide binding]; other site" /db_xref="CDD:198179" misc_feature order(1597..1599,1630..1632,1636..1638,1642..1644, 1657..1665,1678..1680,1696..1698,1729..1737) /gene="Shc3" /gene_synonym="ShcC" /note="hydrophobic binding pocket [polypeptide binding]; other site" /db_xref="CDD:198179" exon 1..474 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 475..545 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 546..609 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 610..729 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 730..783 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 784..835 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 836..962 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 963..1113 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 1114..1201 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 1202..1360 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 1361..1656 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" exon 1657..1968 /gene="Shc3" /gene_synonym="ShcC" /inference="alignment:Splign:2.1.0" ORIGIN
atgcttccacgcaccaagtacaaccgcttcaggaatgactcggtgacatcggtcgatgaccttctccacagcctgtcggtgagcggcagcggcggcaaggtctcggcggagcccgcggcgagcccctacctggtgtcgggcgaggcgctgcgcaaggcgccggacgatgggcccggcagcctgggccacctgctccacaaggtgtcccacttgaaactctccagctccggcctgcgtggcctgtcgtcggccgcccgggagcgggcaggagcgcggctctcgggcagctgcagcgcgcccagcctggcggccccggacggtggcagcgcgacccccgggtcccgtgccccggccgccagcatgagcgccaccaggaagagccgggccagcgacgagccgttgcccaggcccccgcggggcgcgccgcacgccagcgaccaggtgctggggtcgggagtcacctatgtggtcaagtacttgggatgcatcgaagttctgcgctcaatgaggtctcttgacttcagtacaagaactcaggttaccagggaagccatcagccgtgtctgcgaagctgtgccaggcgccaaaggagccttcaagaagagaaagcctccgagtaaaatgctgtccagcatcctggggaagagcaacctccagttcgcagggatgagcatctccctgaccatctccaccgccagcctgaacctgcgcactcctgactccaaacagatcatagcgaaccatcacatgcggtccatctccttcgcctcagggggagacccggacacaacagactatgttgcctacgtcgctaaggaccctgtgaatcgcagagcttgccacattctggaatgctgtgacgggctagcccaagatgtcatcggctccatcggacaagcctttgaactccggttcaagcagtatttgcagtgtccttccaagattcctgctctccaggaccgaatgcagagtctggacgagccgtggactgaagaagagggagatggccccgatcacccgtactacaacagcgttcccaacaagatgcctcctccaggagggtttctcgatgctcgattgaaagccagaccccacgctcctgatgcagcccagttttcaggaaaagagcaaacttattaccagggaagacacttaggagatgcattcggtgaagactggcagagagcacccaccaggcaaggctccttggacatctatagcacaccagaagggaaagctcacatggttcctgtaggagaaacaccaacctatgtcaacacccagccagtcccaccacaggtttggccagcagcaaccagcagcactgagagcagcccacggaaggacctctttgacatgaagccttttgaagatgccctcagaaaccaacccctgggccctgtgttgagcaaagctgcgtctgtggagtgtatcagccccgttacacccagagccccggacgccaagatgctggaggagcttaatgctgagccctggtaccaaggcgagatgagcaggaaggaggcagaggctctactacaggaagatggagacttcctagtcaggaagagtaccaccaaccccggctcctttgtcctcacaggcatgcacaatggccaggccaagcacctgctgctggtggacccggaaggcacggtccggacgaaggacagggtctttgacagcatcagtcacctcattacttaccacctggagagcagcctgcccattgtctctgccgggagtgagctttgtctccggcaaccagtggagaggaaaccctgagcttgccctgcgcccaggtcaggaggacctgggctccgctgctcttagcctatggaatctggggcaactgtctgtgggcccatcaccttcttcaaaagccccgtgagagaggtttccttcaaattcaaatttcataaatatgttcacatgactcagatgcatagtagaaatgtatatacccac
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]