GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 23:31:06, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus killer cell lectin-like receptor subfamily B, member 1A (Klrb1a), mRNA. (1014 bp)
cactggtgacactgaaaaggacagctgtgcctccgtctcacaggacaaagtgctttctgagagctgtgattcagacaatatatgggtctgccaaaaggaactaaaatgtgaatgcatgtgtaatgactcctgactgcgaatcacacctggattactttaccatccacaccagatctctgcctgacctgtctgtctctgctgcctgcctcccagtgcagcactggcacaaagcatggactctgaaagcactgagtcttatagagtcttcgttgtgtagatgtaaacgtacgcagacacagatgtgccatcctgtgagggagttctgtggaaagaagaccaggcagctgagggtcactggattctaatcctggagtctgtgtgaccttcgttggtctctgtgtctgaggtcatctgcaaaatagccatttgcaaaaatcattaaaatgctcctctgcaggg
position 731 734 737 791 797 800 902 905 914 920 923 926 929 956 962 968
Synonym: NKR-P1A; Nkrp1a
NM_001010964.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/M62891_at
lang : en | div : | spe : rn | query_string : M62891_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAAAATAGCCATTTGCAAAAATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGACCTGTCTGTCTCTGCTGCCTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.542 | 0.443 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGTGTGACCTTCGTTGGTCTCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.557 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCCTGACCTGTCTGTCTCTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.566 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGAGGTCATCTGCAAAATAGCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.575 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCATCTGCAAAATAGCCATTTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.583 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCACTGGATTCTAATCCTGGAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.591 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTGACCTGTCTGTCTCTGCTGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.600 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGTCTGTGTGACCTTCGTTGGTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.610 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGGTCACTGGATTCTAATCCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.622 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTCTGAAAGCACTGAGTCTTATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.632 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAAGCACTGAGTCTTATAGAGTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.643 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGAGTCTGTGTGACCTTCGTTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.654 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTCTAATCCTGGAGTCTGTGTGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.665 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCCTGGAGTCTGTGTGACCTTCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.680 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCACTGAGTCTTATAGAGTCTTCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.703 | 0.024 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAAAATAGCCATTTGCAAAAATC)%26(nt:TGACCTGTCTGTCTCTGCTGCCTGC)%26(nt:TCTGTGTGACCTTCGTTGGTCTCTG)%26(nt:TCTGCCTGACCTGTCTGTCTCTGCT)%26(nt:TCTGAGGTCATCTGCAAAATAGCCA)%26(nt:GTCATCTGCAAAATAGCCATTTGCA)%26(nt:GGTCACTGGATTCTAATCCTGGAGT)%26(nt:GCCTGACCTGTCTGTCTCTGCTGCC)%26(nt:GAGTCTGTGTGACCTTCGTTGGTCT)%26(nt:GAGGGTCACTGGATTCTAATCCTGG)%26(nt:GACTCTGAAAGCACTGAGTCTTATA)%26(nt:GAAAGCACTGAGTCTTATAGAGTCT)%26(nt:CTGGAGTCTGTGTGACCTTCGTTGG)%26(nt:ATTCTAATCCTGGAGTCTGTGTGAC)%26(nt:ATCCTGGAGTCTGTGTGACCTTCGT)%26(nt:AGCACTGAGTCTTATAGAGTCTTCG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.705 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]