GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-10-29 01:54:30, GGRNA : RefSeq release 207 (Jul, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus neurotrophic receptor tyrosine kinase 2 (Ntrk2), transcript variant X5, mRNA. (4188 bp)
agagttgatgcatttctcacgggttattctacagagcttttgtcaagtccaatggaaggaggtagattcttgttcagatatgatttcgggaaaaaccgagtccttgacaaagacaggagacaccctcagttgggaggcaagtttctcttaccttggactttctcacacagcaattctcacccccaccccctccactctcacctgtcttgtaactgtgcaaacaaaagtgtgcatggtctttgtcagttgatacctttgtgcacctctgtgcagaaactgctgtctgtcccggctgtggtacccgatcagtggggtagatccacgaaaggtctcattttaggccgctttgggaaggtaaccagatcggtagctggaagcactctccagtaggtggcgaagggtgagtgggtctgctgaagcctgcatatcttcacccacctcaaacccaccgggctgcacaggggacaggcacaggccacccctgagggacagggaagctctcttgggataccacctgagtttacattcagtgtgctcaggtcaagtctctcgctcggggctctgtttcggggagaatggtttcattccaacgcactcatt...
position 3524 3548 3668 3674 3716 3758 3764 3776 3788 3878 3884 3926 3932 4046 4052 4094
Synonym: RATTRKB1; Tkrb; trk-B; trkB; TRKB1
XM_039095371.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus neurotrophic receptor tyrosine kinase 2 (Ntrk2), transcript variant 1, mRNA. (4750 bp)
agagttgatgcatttctcacgggttattctacagagcttttgtcaagtccaatggaaggaggtagattcttgttcagatatgatttcgggaaaaaccgagtccttgacaaagacaggagacaccctcagttgggaggcaagtttctcttaccttggactttctcacacagcaattctcacccccaccccctccactctcacctgtcttgtaactgtgcaaacaaaagtgtgcatggtctttgtcagttgatacctttgtgcacctctgtgcagaaactgctgtctgtcccggctgtggtacccgatcagtggggtagatccacgaaaggtctcattttaggccgctttgggaaggtaaccagatcggtagctggaagcactctccagtaggtggcgaagggtgagtgggtctgctgaagcctgcatatcttcacccacctcaaacccaccgggctgcacaggggacaggcacaggccacccctgagggacagggaagctctcttgggataccacctgagtttacattcagtgtgctcaggtcaagtctctcgctcggggctctgtttcggggagaatggtttcattccaacgcactcatt...
position 4137 4161 4281 4287 4329 4371 4377 4389 4401 4491 4497 4539 4545 4659 4665 4707
Synonym: RATTRKB1; Tkrb; trk-B; trkB; TRKB1
NM_012731.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/M55291_at
lang : en | div : | spe : rn | query_string : M55291_at | format : html | download :

0.000 | 0.000 | search_start;
0.094 | 0.094 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTGCACCTCTGTGCAGAAACTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.127 | 0.033 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAGTGTGCTCAGGTCAAGTCTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.138 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTACCTTGGACTTTCTCACACAGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.151 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGTCTGCTGAAGCCTGCATATCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.161 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGACTTTCTCACACAGCAATTCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.169 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCTGAAGCCTGCATATCTTCACCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.180 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCACCTGTCTTGTAACTGTGCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.192 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTACAGAGCTTTTGTCAAGTCCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.201 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGGTAGCTGGAAGCACTCTCCAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.209 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGATGCATTTCTCACGGGTTATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.218 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCTCAGGTCAAGTCTCTCGCTCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.231 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCAGAAACTGCTGTCTGTCCCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.242 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGGTTTCATTCCAACGCACTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.252 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTTGTCAGTTGATACCTTTGTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.261 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGTTGATACCTTTGTGCACCTCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.275 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCAGATCGGTAGCTGGAAGCACTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.301 | 0.026 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTGCACCTCTGTGCAGAAACTGC)%26(nt:TTCAGTGTGCTCAGGTCAAGTCTCT)%26(nt:TTACCTTGGACTTTCTCACACAGCA)%26(nt:TGGGTCTGCTGAAGCCTGCATATCT)%26(nt:TGGACTTTCTCACACAGCAATTCTC)%26(nt:TGCTGAAGCCTGCATATCTTCACCC)%26(nt:TCTCACCTGTCTTGTAACTGTGCAA)%26(nt:TCTACAGAGCTTTTGTCAAGTCCAA)%26(nt:TCGGTAGCTGGAAGCACTCTCCAGT)%26(nt:GTTGATGCATTTCTCACGGGTTATT)%26(nt:GTGCTCAGGTCAAGTCTCTCGCTCG)%26(nt:GTGCAGAAACTGCTGTCTGTCCCGG)%26(nt:GAATGGTTTCATTCCAACGCACTCA)%26(nt:CTTTGTCAGTTGATACCTTTGTGCA)%26(nt:CAGTTGATACCTTTGTGCACCTCTG)%26(nt:ACCAGATCGGTAGCTGGAAGCACTC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.303 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]