GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:07:44, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X10, mRNA. (1880 bp)
ggcattaaggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagat...
position 1255 1324 1339 1568 1654 1683 1690 1698 1705 1712 1718 1728 1761 1768 1774 1802
Synonym: Ck2b
XM_017599071.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X11, mRNA. (1882 bp)
ctggagcctcaaaccaccgttatccataacccagtggacggcattaaggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaagatga...
position 1335 1404 1419 1570 1656 1685 1692 1700 1707 1714 1720 1730 1763 1770 1776 1804
Synonym: Ck2b
XM_017599072.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X9, mRNA. (1883 bp)
ggcattaaggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagat...
position 1258 1327 1342 1571 1657 1686 1693 1701 1708 1715 1721 1731 1764 1771 1777 1805
Synonym: Ck2b
XM_006251177.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X8, mRNA. (1911 bp)
gccgccctggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagat...
position 1286 1355 1370 1599 1685 1714 1721 1729 1736 1743 1749 1759 1792 1799 1805 1833
Synonym: Ck2b
XM_006251176.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X7, mRNA. (2213 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1216 1657 1672 1901 1987 2016 2023 2031 2038 2045 2051 2061 2094 2101 2107 2135
Synonym: Ck2b
XM_017599070.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X6, mRNA. (2216 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1219 1660 1675 1904 1990 2019 2026 2034 2041 2048 2054 2064 2097 2104 2110 2138
Synonym: Ck2b
XM_006251174.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X4, mRNA. (2257 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1260 1701 1716 1945 2031 2060 2067 2075 2082 2089 2095 2105 2138 2145 2151 2179
Synonym: Ck2b
XM_017599068.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X5, mRNA. (2258 bp)
tcaccagccccaaaggatccctccctcctgccgccctggagcctcaaaccaccgttatccataacccagtggacggcattaaggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccccagggtccctgatgtcctgagcttggtgaggaggggctcaggagccccagaagccgagggcccc...aagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagacc...gacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccaga...
position 1339 1780 1795 1946 2032 2061 2068 2076 2083 2090 2096 2106 2139 2146 2152 2180
Synonym: Ck2b
XM_017599069.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X3, mRNA. (2260 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1263 1704 1719 1948 2034 2063 2070 2078 2085 2092 2098 2108 2141 2148 2154 2182
Synonym: Ck2b
XM_006251172.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X2, mRNA. (2288 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1291 1732 1747 1976 2062 2091 2098 2106 2113 2120 2126 2136 2169 2176 2182 2210
Synonym: Ck2b
XM_006251171.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant X1, mRNA. (2333 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1336 1777 1792 2021 2107 2136 2143 2151 2158 2165 2171 2181 2214 2221 2227 2255
Synonym: Ck2b
XM_006251170.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant 3, mRNA. (3747 bp)
gccgccctggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagat...
position 1147 1216 1231 1460 1546 1575 1582 1590 1597 1604 1610 1620 1653 1660 1666 1694
Synonym: Ck2b
NM_001042356.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant 2, mRNA. (3864 bp)
ggcattaaggaatcttccgacagcaccaacacaaccatagaggacgaagatgccaaagcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagat...
position 1264 1333 1348 1577 1663 1692 1699 1707 1714 1721 1727 1737 1770 1777 1783 1811
Synonym: Ck2b
NM_021739.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus calcium/calmodulin-dependent protein kinase II beta (Camk2b), transcript variant 1, mRNA. (4005 bp)
tccctggccccttgcccaccccatcccggaagcaggaaatcatcaagaccacagagcagctcatcgaggccgtcaacaacggcgactttgaggcctatgcgaaaatctgtgacccaggcctgacctcatttgagcctgaagctctgggcaacctggtcgaagggatggatttccacagattctactttgagaacctgctggccaagaacagcaagccgatccacaccactatcctgaacccgcacgtgcacgtcatcggcgaggatgcagcctgcatcgcttacatccgcctcacacagtacatcgacggccagggcagaccccgcaccagccagtccgaagagacccgtgtgtggcaccgccgcgacggcaagtggcagaatgtccatttccactgctcgggcgctccagtggccccactgcagtgagagctgcgcctggtttcaccggacagagttggtgtttggagcccagccgccctcgggcgcacggcctgcctgtcgcatgtttgtgtctgcctcgtcccctcccctggtgcctgtgtctgcagaaaaacaagaccagatgtgatttgtttttttaaaaaaaaaaaaaaagtaa...
position 1147 1474 1489 1718 1804 1833 1840 1848 1855 1862 1868 1878 1911 1918 1924 1952
Synonym: Ck2b
NM_001042354.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/M16112_g_at
lang : en | div : | spe : rn | query_string : M16112_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.081 | 0.081 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCGACAGCACCAACACAACCATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.088 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCCTGGTGCCTGTGTCTGCAGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.096 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCACCGGACAGAGTTGGTGTTTGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.103 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCGCATGTTTGTGTCTGCCTCGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.111 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGCGCCTGGTTTCACCGGACAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.119 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCACGGCCTGCCTGTCGCATGTTTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.127 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGTTGGTGTTTGGAGCCCAGCCGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.134 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGTCCATTTCCACTGCTCGGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.141 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGTTTCACCGGACAGAGTTGGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.148 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCCTGTCGCATGTTTGTGTCTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.155 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGAGGCCGTCAACAACGGCGACTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.162 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCACTGCAGTGAGAGCTGCGCCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.169 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGTGGCCCCACTGCAGTGAGAGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.177 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACAGAGCAGCTCATCGAGGCCGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.184 | 0.007 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTGAGAGCTGCGCCTGGTTTCACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.191 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACACAGTACATCGACGGCCAGGGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.348 | 0.157 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCGACAGCACCAACACAACCATA)%26(nt:TCCCCTGGTGCCTGTGTCTGCAGAA)%26(nt:TCACCGGACAGAGTTGGTGTTTGGA)%26(nt:GTCGCATGTTTGTGTCTGCCTCGTC)%26(nt:GCTGCGCCTGGTTTCACCGGACAGA)%26(nt:GCACGGCCTGCCTGTCGCATGTTTG)%26(nt:GAGTTGGTGTTTGGAGCCCAGCCGC)%26(nt:GAATGTCCATTTCCACTGCTCGGGC)%26(nt:CTGGTTTCACCGGACAGAGTTGGTG)%26(nt:CTGCCTGTCGCATGTTTGTGTCTGC)%26(nt:CGAGGCCGTCAACAACGGCGACTTT)%26(nt:CCCACTGCAGTGAGAGCTGCGCCTG)%26(nt:CAGTGGCCCCACTGCAGTGAGAGCT)%26(nt:CACAGAGCAGCTCATCGAGGCCGTC)%26(nt:AGTGAGAGCTGCGCCTGGTTTCACC)%26(nt:ACACAGTACATCGACGGCCAGGGCA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.361 | 0.012 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]