GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:10:30, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus myosin heavy chain 2 (Myh2), mRNA. (6041 bp)
gcgtctggacgaggctgagcagctggcgctgaagggcggcaagaagcagatccagaaactggaggccagagtgcgtgaactggagggtgaggtagagagtgagcagaagcggaatgttgaggctgtcaaagggcttcgaaaacacgagaggcgagtgaaggagcttacttaccagacagaagaagaccgaaaaaatatcctcaggcttcaagatttggtggataaactccaagcaaaagtaaaatcttacaagagacaagctgaggaggctgaggaacaatccaacacaaatctatccaagttccgcaagctgcagcatgagctggaggaagccgaggagcgggctgacatcgccgagtcccaggtcaacaagctgcgggtgaagagccgcgaggttcacactaaagtcataagtgaagagtaaggcagctctgatgctgtagaatgaccgaagagaggcacaaaatgtgaagcctttggtcatgtccccatgtgattctatttaatcctattgtaaggaaataaagagcccaagttctttgcaagcaata
position 5603 5606 5612 5621 5624 5627 5687 5690 5696 5912 5915 5918 5954 5957 5960 5963
Synonym: Myh1; Myh2a; MyHC-2A; MyHC-IIA
NM_001135157.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/L13606_at
lang : en | div : | spe : rn | query_string : L13606_at | format : html | download :

0.000 | 0.000 | search_start;
0.096 | 0.096 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGAAGCCTTTGGTCATGTCCCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.107 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAGGCAGCTCTGATGCTGTAGAAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.118 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGAGGCTGTCAAAGGGCTTCGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.128 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGCTTCGAAAACACGAGAGGCGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.138 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCAGCTCTGATGCTGTAGAATGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.148 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGTCAAAGGGCTTCGAAAACACG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.160 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTTTGGTCATGTCCCCATGTGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.171 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGCCTTTGGTCATGTCCCCATGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.181 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCGAAAACACGAGAGGCGAGTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.192 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCAAGATTTGGTGGATAAACTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.203 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCAGGCTTCAAGATTTGGTGGATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGAAAACACGAGAGGCGAGTGAAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCCTCAGGCTTCAAGATTTGGTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.235 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCTCTGATGCTGTAGAATGACCGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.245 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATGTTGAGGCTGTCAAAGGGCTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.255 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAATGTGAAGCCTTTGGTCATGTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.279 | 0.023 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGAAGCCTTTGGTCATGTCCCCA)%26(nt:TAAGGCAGCTCTGATGCTGTAGAAT)%26(nt:GTTGAGGCTGTCAAAGGGCTTCGAA)%26(nt:GGGCTTCGAAAACACGAGAGGCGAG)%26(nt:GGCAGCTCTGATGCTGTAGAATGAC)%26(nt:GCTGTCAAAGGGCTTCGAAAACACG)%26(nt:GCCTTTGGTCATGTCCCCATGTGAT)%26(nt:GAAGCCTTTGGTCATGTCCCCATGT)%26(nt:CTTCGAAAACACGAGAGGCGAGTGA)%26(nt:CTTCAAGATTTGGTGGATAAACTCC)%26(nt:CTCAGGCTTCAAGATTTGGTGGATA)%26(nt:CGAAAACACGAGAGGCGAGTGAAGG)%26(nt:ATCCTCAGGCTTCAAGATTTGGTGG)%26(nt:AGCTCTGATGCTGTAGAATGACCGA)%26(nt:AATGTTGAGGCTGTCAAAGGGCTTC)%26(nt:AAATGTGAAGCCTTTGGTCATGTCC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.280 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]