GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 23:42:40, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X4, mRNA. (3362 bp)
gaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatattta...
position 2796 2807 2857 2896 2957 2967 3004 3014 3032 3128 3137 3146 3157 3167 3186 3201
Synonym: Rgds
XM_017591589.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X1, mRNA. (3630 bp)
gaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatattta...
position 3064 3075 3125 3164 3225 3235 3272 3282 3300 3396 3405 3414 3425 3435 3454 3469
Synonym: Rgds
XM_006233750.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X2, mRNA. (3673 bp)
gaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatattta...
position 3107 3118 3168 3207 3268 3278 3315 3325 3343 3439 3448 3457 3468 3478 3497 3512
Synonym: Rgds
XM_006233751.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), mRNA. (3684 bp)
gaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatattta...
position 3109 3120 3170 3209 3270 3280 3317 3327 3345 3441 3450 3459 3470 3480 3499 3514
Synonym: Rgds
NM_019250.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X5, mRNA. (3697 bp)
gaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatattta...
position 3131 3142 3192 3231 3292 3302 3339 3349 3367 3463 3472 3481 3492 3502 3521 3536
Synonym: Rgds
XM_006233753.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X3, mRNA. (3733 bp)
gaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatattta...
position 3167 3178 3228 3267 3328 3338 3375 3385 3403 3499 3508 3517 3528 3538 3557 3572
Synonym: Rgds
XM_006233752.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/L07925_g_at
lang : en | div : | spe : rn | query_string : L07925_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCATTGAACCCCATACCACTGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.104 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCCTGGACAATGTCCACCACACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.115 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAAAGTGCCATTCACCACCGCTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.126 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCATGGACCGCCTGGTTGGCATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.136 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACAAGACTACATGCAATGGGAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.147 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGCTGCCAACTGCGTTCTCTCCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.157 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAACCAGAGGACTAGCTGACTTTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.165 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGGTCCTAGCCTTTCTTAGGCTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.174 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTTCATGGAGGTCCTAGCCTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.186 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCGTTCTCTCCTTGTGCCCATAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.196 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTGCGTCCCGGGTGTACAAGACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.206 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGCCTGGTTGGCATTGAACCCCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.216 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCATACCACTGAAAGTGCCATTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAAGTGCAGATCACTGCCACCCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.233 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGCTGCACCAAAGATTCCACCTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.241 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTAGCTGACTTTGCCAAGGGGTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.337 | 0.096 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCATTGAACCCCATACCACTGAA)%26(nt:TGCCCTGGACAATGTCCACCACACT)%26(nt:TGAAAGTGCCATTCACCACCGCTGC)%26(nt:TCTCATGGACCGCCTGGTTGGCATT)%26(nt:GTACAAGACTACATGCAATGGGAGG)%26(nt:GGGCTGCCAACTGCGTTCTCTCCTT)%26(nt:GCAACCAGAGGACTAGCTGACTTTG)%26(nt:GAGGTCCTAGCCTTTCTTAGGCTGC)%26(nt:GACCTTCATGGAGGTCCTAGCCTTT)%26(nt:CTGCGTTCTCTCCTTGTGCCCATAG)%26(nt:CGCTGCGTCCCGGGTGTACAAGACT)%26(nt:CCGCCTGGTTGGCATTGAACCCCAT)%26(nt:CCCATACCACTGAAAGTGCCATTCA)%26(nt:CCAAGTGCAGATCACTGCCACCCAT)%26(nt:AGGCTGCACCAAAGATTCCACCTTC)%26(nt:ACTAGCTGACTTTGCCAAGGGGTGC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.342 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]