GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 23:06:17, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X4, mRNA. (3362 bp)
ctatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccacctt...
position 2714 2720 2726 2729 2735 2738 2744 2756 2765 2768 2774 2780 2783 2786 2789 2795
Synonym: Rgds
XM_017591589.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X1, mRNA. (3630 bp)
ctatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccacctt...
position 2982 2988 2994 2997 3003 3006 3012 3024 3033 3036 3042 3048 3051 3054 3057 3063
Synonym: Rgds
XM_006233750.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X2, mRNA. (3673 bp)
ctatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccacctt...
position 3025 3031 3037 3040 3046 3049 3055 3067 3076 3079 3085 3091 3094 3097 3100 3106
Synonym: Rgds
XM_006233751.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), mRNA. (3684 bp)
ctatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccacctt...
position 3027 3033 3039 3042 3048 3051 3057 3069 3078 3081 3087 3093 3096 3099 3102 3108
Synonym: Rgds
NM_019250.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X5, mRNA. (3697 bp)
ctatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccacctt...
position 3049 3055 3061 3064 3070 3073 3079 3091 3100 3103 3109 3115 3118 3121 3124 3130
Synonym: Rgds
XM_006233753.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X3, mRNA. (3733 bp)
ctatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccacctt...
position 3085 3091 3097 3100 3106 3109 3115 3127 3136 3139 3145 3151 3154 3157 3160 3166
Synonym: Rgds
XM_006233752.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/L07925_at
lang : en | div : | spe : rn | query_string : L07925_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAACCAGAGGACTAGCTGACTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.265 | 0.180 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGACAGGCTGACCTGGCCTCCGGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.278 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCTCTCTGCAACCAGAGGACTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.599 | 0.321 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCGGGGACCGCTCACCGCCTTAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.611 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCACCGCCTTAGGTGCCTTCTGCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.623 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCCTTCTGCTCTCTGCAACCAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.633 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGATTGACACCTGCCACTGACAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.645 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGCCGGGATTGACACCTGCCACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.656 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGACCTGGCCTCCGGGGACCGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.980 | 0.324 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTCTCTGCAACCAGAGGACTAGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.031 | 0.051 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACACCTGCCACTGACAGGCTGACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.043 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTCACCGCCTTAGGTGCCTTCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.055 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTTCTGCTCTCTGCAACCAGAGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.065 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTTAGGTGCCTTCTGCTCTCTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.497 | 0.432 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACTGACAGGCTGACCTGGCCTCCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.509 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCTGCCACTGACAGGCTGACCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.594 | 0.084 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCAACCAGAGGACTAGCTGACTTT)%26(nt:TGACAGGCTGACCTGGCCTCCGGGG)%26(nt:TCTGCTCTCTGCAACCAGAGGACTA)%26(nt:TCCGGGGACCGCTCACCGCCTTAGG)%26(nt:TCACCGCCTTAGGTGCCTTCTGCTC)%26(nt:GTGCCTTCTGCTCTCTGCAACCAGA)%26(nt:GGGATTGACACCTGCCACTGACAGG)%26(nt:GCTGCCGGGATTGACACCTGCCACT)%26(nt:GCTGACCTGGCCTCCGGGGACCGCT)%26(nt:GCTCTCTGCAACCAGAGGACTAGCT)%26(nt:GACACCTGCCACTGACAGGCTGACC)%26(nt:CGCTCACCGCCTTAGGTGCCTTCTG)%26(nt:CCTTCTGCTCTCTGCAACCAGAGGA)%26(nt:CCTTAGGTGCCTTCTGCTCTCTGCA)%26(nt:CACTGACAGGCTGACCTGGCCTCCG)%26(nt:ACCTGCCACTGACAGGCTGACCTGG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.599 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]