GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:23:12, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus crystallin, gamma C (Crygc), transcript variant 1, mRNA. (617 bp)
gtggacagtggctgctggatgctctatgagcgacccaactaccagggccaccagtacttcctgcgacgcggggactaccctgactaccagcagtggatgggtttcagcgactccattcgctcctgccgcctcatcccccatcagacaggttcccacaggatgcgtctgtatgagaaagaagatcacaaaggcgtcatgatggagctgagtgaagactgctcctgcatccaggaccgcttccacctcagtgaggtgcgctcgctgcacgtgctagagggctgctgggtcctctatgagatgtctaactaccgaggccggcagtatctgctgaggcctcaagagtaccggcgctaccacgactggggcgctgtagatgctaaggcaggctctttgcggagggtggtagatttatactaaaataggtgaacgctaccattttctcattttggaacctaataaagtatttagtctgtattgttggcaaaaaaaaaaaaaaaaa
position 275 296 299 302 306 310 314 355 358 361 369 374 377 442 478 485 492 538 541 544
Synonym: Cryg; Cryg3; Len
NM_033483.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus crystallin, gamma C (Crygc), transcript variant 2, mRNA. (618 bp)
cgcgtggacagtggctgctggatgctctatgagcgccccaactaccagggccaccagtacttcctgcgacgcggggactaccctgactaccagcagtggatgggtttcagcgactccattcgctcctgccgcctcatcccccatacaggttcccacaggatgcgtctgtatgagaaagaagatcacaaaggcgtcatgatggagctgagtgaagactgctcctgcatccaggaccgcttccacctcagtgaggtgcgctcgctgcacgtgctagagggctgctgggtcctctatgagatgcctaactaccgaggccggcagtatctgctgaggcctcaagagtaccggcgctaccacgactggggcgctgtagatgctaaggcaggctctttgcggagggtggtagatttatactaaaataggtgaacgctaccattttctcattttggaacctaataaagtatttagtctgtattgttggca
position 292 313 316 319 323 327 331 372 375 378 386 391 394 459 495 502 509 555 558 561
Synonym: Cryg; Cryg3; Len
NM_001081660.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/J00717mRNA_s_at
lang : en | div : | spe : rn | query_string : J00717mRNA_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCTGAGGCCTCAAGAGTACCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.098 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGCTGCACGTGCTAGAGGGCTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.108 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAGGTGAACGCTACCATTTTCTCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.118 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGAACGCTACCATTTTCTCATTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.127 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGTAGATGCTAAGGCAGGCTCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.137 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCACAAAGGCGTCATGATGGAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.149 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGATCACAAAGGCGTCATGATGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.158 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCCACCTCAGTGAGGTGCGCTCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.168 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGGGCGCTGTAGATGCTAAGGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.177 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTCATGATGGAGCTGAGTGAAGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.187 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTCGCTGCACGTGCTAGAGGGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.196 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTCAGTGAGGTGCGCTCGCTGCAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.209 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCACCTCAGTGAGGTGCGCTCGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.219 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACAAAGGCGTCATGATGGAGCTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.232 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGCTAAGGCAGGCTCTTTGCGGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.243 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGATGGAGCTGAGTGAAGACTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.253 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGTGCGCTCGCTGCACGTGCTAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.264 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGATGCGTCTGTATGAGAAAGAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.275 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGGCGTCATGATGGAGCTGAGTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.285 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACGCTACCATTTTCTCATTTTGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.327 | 0.042 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCTGAGGCCTCAAGAGTACCGG)%26(nt:TCGCTGCACGTGCTAGAGGGCTGCT)%26(nt:TAGGTGAACGCTACCATTTTCTCAT)%26(nt:GTGAACGCTACCATTTTCTCATTTT)%26(nt:GCTGTAGATGCTAAGGCAGGCTCTT)%26(nt:GATCACAAAGGCGTCATGATGGAGC)%26(nt:GAAGATCACAAAGGCGTCATGATGG)%26(nt:CTTCCACCTCAGTGAGGTGCGCTCG)%26(nt:CTGGGGCGCTGTAGATGCTAAGGCA)%26(nt:CGTCATGATGGAGCTGAGTGAAGAC)%26(nt:CGCTCGCTGCACGTGCTAGAGGGCT)%26(nt:CCTCAGTGAGGTGCGCTCGCTGCAC)%26(nt:CCACCTCAGTGAGGTGCGCTCGCTG)%26(nt:CACAAAGGCGTCATGATGGAGCTGA)%26(nt:ATGCTAAGGCAGGCTCTTTGCGGAG)%26(nt:ATGATGGAGCTGAGTGAAGACTGCT)%26(nt:AGGTGCGCTCGCTGCACGTGCTAGA)%26(nt:AGGATGCGTCTGTATGAGAAAGAAG)%26(nt:AAGGCGTCATGATGGAGCTGAGTGA)%26(nt:AACGCTACCATTTTCTCATTTTGGA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.329 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]