GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:17:55, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus serine threonine kinase 39 (Stk39), mRNA. (3551 bp)
cccgcactacacatggaggcatacgtttgcttcatctggacatttagaatactgtacctgtgctgccgttctgttagatcgctgactacatccccgtgtctgattcggctctccttaggtgataggattcattgtttgtaaggcgataaacttgaccacaccagaatctgagttttacttgaaactctgcagaatacacagggggtatgaaaaacaaaacaaaacaaaacagaaagatttttttgtgcaatggcaaaaggtaaaaatgctgtaaacgttcgagaataaatatttccaacccaagaacctcctgcttgactatgtattatgaacctaacaaaccttaggattttcaaatttggagtcaaaaccctcaagaaggtggctccggggatggcaccattgctccttacaagctaaccctagatgcggcagctctttaacgtactttaaaaagcaaatatatattactaaggaaagaagttatttataattgccttgtcataatcgttaaggtgttctagaaccatttgcatacaatttaatgtaattccattccattctattgtttacacaattactcaaagatggctgcaaagg...
position 3208 3210 3211 3212 3213 3215 3216 3217 3218 3219 3220 3223 3224 3225 3226 3227 3228 3229 3230 3231
Synonym: Spak
NM_019362.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus serine threonine kinase 39 (Stk39), transcript variant X2, mRNA. (2987 bp)
cccgcactacacatggaggcatacgtttgcttcatctggacatttagaatactgtacctgtgctgccgttctgttagatcgctgactacatccccgtgtctgattcggctctccttaggtgataggattcattgtttgtaaggcgataaacttgaccacaccagaatctgagttttacttgaaactctgcagaatacacagggggtatgaaaaacaaaacaaaacaaaacagaaagatttttttgtgcaatggcaaaaggtaaaaatgctgtaaacgttcgagaataaatatttccaacccaagaacctcctgcttgactatgtattatgaacctaacaaaccttaggattttcaaatttggagtcaaaaccctcaagaaggtggctccggggatggcaccattgctccttacaagctaaccctagatgcggcagctctttaacgtactttaaaaagcaaatatatattactaaggaaagaagttatttataattgccttgtcataatcgttaaggtgttctagaaccatttgcatacaatttaatgtaattccattccattctattgtttacacaattactcaaagatggctgcaaagg...
position 2642 2644 2645 2646 2647 2649 2650 2651 2652 2653 2654 2657 2658 2659 2660 2661 2662 2663 2664 2665
Synonym: Spak
XM_017591998.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus serine threonine kinase 39 (Stk39), transcript variant X1, mRNA. (3291 bp)
cccgcactacacatggaggcatacgtttgcttcatctggacatttagaatactgtacctgtgctgccgttctgttagatcgctgactacatccccgtgtctgattcggctctccttaggtgataggattcattgtttgtaaggcgataaacttgaccacaccagaatctgagttttacttgaaactctgcagaatacacagggggtatgaaaaacaaaacaaaacaaaacagaaagatttttttgtgcaatggcaaaaggtaaaaatgctgtaaacgttcgagaataaatatttccaacccaagaacctcctgcttgactatgtattatgaacctaacaaaccttaggattttcaaatttggagtcaaaaccctcaagaaggtggctccggggatggcaccattgctccttacaagctaaccctagatgcggcagctctttaacgtactttaaaaagcaaatatatattactaaggaaagaagttatttataattgccttgtcataatcgttaaggtgttctagaaccatttgcatacaatttaatgtaattccattccattctattgtttacacaattactcaaagatggctgcaaagg...
position 2946 2948 2949 2950 2951 2953 2954 2955 2956 2957 2958 2961 2962 2963 2964 2965 2966 2967 2968 2969
Synonym: Spak
XM_008761922.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/D88190_s_at
lang : en | div : | spe : rn | query_string : D88190_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCAACCCAAGAACCTCCTGCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.102 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCCAACCCAAGAACCTCCTGCTTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.112 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCTTGACTATGTATTATGAACCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.122 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCTGCTTGACTATGTATTATGAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.132 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCAACCCAAGAACCTCCTGCTTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.143 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACCTCCTGCTTGACTATGTATTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.154 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCTTGACTATGTATTATGAACCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.165 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCTGCTTGACTATGTATTATGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.176 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGCTTGACTATGTATTATGAACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.186 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTCCTGCTTGACTATGTATTATGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.195 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAAGAACCTCCTGCTTGACTATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.205 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAAGAACCTCCTGCTTGACTATGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAAGAACCTCCTGCTTGACTATGTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAACCCAAGAACCTCCTGCTTGACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.236 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTCCAACCCAAGAACCTCCTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.247 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATATTTCCAACCCAAGAACCTCCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.257 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCTCCTGCTTGACTATGTATTATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.268 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCCAAGAACCTCCTGCTTGACTAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.277 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCTCCTGCTTGACTATGTATTAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.288 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCCAAGAACCTCCTGCTTGACTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.327 | 0.039 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCAACCCAAGAACCTCCTGCTT)%26(nt:TTCCAACCCAAGAACCTCCTGCTTG)%26(nt:TGCTTGACTATGTATTATGAACCTA)%26(nt:TCCTGCTTGACTATGTATTATGAAC)%26(nt:TCCAACCCAAGAACCTCCTGCTTGA)%26(nt:GAACCTCCTGCTTGACTATGTATTA)%26(nt:CTGCTTGACTATGTATTATGAACCT)%26(nt:CTCCTGCTTGACTATGTATTATGAA)%26(nt:CCTGCTTGACTATGTATTATGAACC)%26(nt:CCTCCTGCTTGACTATGTATTATGA)%26(nt:CCCAAGAACCTCCTGCTTGACTATG)%26(nt:CCAAGAACCTCCTGCTTGACTATGT)%26(nt:CAAGAACCTCCTGCTTGACTATGTA)%26(nt:CAACCCAAGAACCTCCTGCTTGACT)%26(nt:ATTTCCAACCCAAGAACCTCCTGCT)%26(nt:ATATTTCCAACCCAAGAACCTCCTG)%26(nt:ACCTCCTGCTTGACTATGTATTATG)%26(nt:ACCCAAGAACCTCCTGCTTGACTAT)%26(nt:AACCTCCTGCTTGACTATGTATTAT)%26(nt:AACCCAAGAACCTCCTGCTTGACTA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.330 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]