GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:36:17, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus dihydrolipoamide S-acetyltransferase (Dlat), mRNA; nuclear gene for mitochondrial product. (2628 bp)
tttaaagtttcactagttaattttattattgagtcagtccagataaattatttgtaatagacataaatgaatcttttgtaaatgccagttacacccaaatgttttacccctttaataattacacatcggtttaaagctgtgtactcctagtgaagggacatgtggcctaactctttggtgagaagaccttcctgggagtatagaatgggcaggattgtggcttcctgcagacagactcataaaagtaacctggatgagatcttggagtttagatttaattgattcaacttatttaagtgtgagggaaacagtcgtgaaaattacttcttatgggaggagtttgaatttacgttggaatctaacagttaaagtctcctgtcacatgaccttagtttatcactcagtaagtgaaacttttaagagtcagcattttcttagacctcttcaaaccaactattatttttatatgaatctctaaataaaatagctttccccacaagataaagatataaaccagcttcttggtataaatgaaattttatgtatttatttataaacaatttcaatgtataacttgagaattctgcagtttcctccaaa...
position 2049 2054 2107 2338 2343 2348 2354 2359 2364 2388 2394 2401 2408 2413 2481 2487
NM_031025.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/D10655_g_at
lang : en | div : | spe : rn | query_string : D10655_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAGACCTCTTCAAACCAACTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.097 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTAAAGCTGTGTACTCCTAGTGAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.112 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCCTGTCACATGACCTTAGTTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.122 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAGAGTCAGCATTTTCTTAGACCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.133 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAAAGTCTCCTGTCACATGACCTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.143 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCACATGACCTTAGTTTATCACTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.153 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAAATGCCAGTTACACCCAAATGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.164 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTTTGTAAATGCCAGTTACACCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.174 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTAGTTTATCACTCAGTAAGTGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGCATTTTCTTAGACCTCTTCAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.194 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGACCTTAGTTTATCACTCAGTAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.205 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATATAAACCAGCTTCTTGGTATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.215 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGACCTCTTCAAACCAACTATTATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.228 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAGTTAAAGTCTCCTGTCACATGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.238 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTTTTAAGAGTCAGCATTTTCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.248 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAACCAGCTTCTTGGTATAAATGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.270 | 0.023 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAGACCTCTTCAAACCAACTA)%26(nt:TTAAAGCTGTGTACTCCTAGTGAAG)%26(nt:TCTCCTGTCACATGACCTTAGTTTA)%26(nt:TAAGAGTCAGCATTTTCTTAGACCT)%26(nt:TAAAGTCTCCTGTCACATGACCTTA)%26(nt:GTCACATGACCTTAGTTTATCACTC)%26(nt:GTAAATGCCAGTTACACCCAAATGT)%26(nt:CTTTTGTAAATGCCAGTTACACCCA)%26(nt:CTTAGTTTATCACTCAGTAAGTGAA)%26(nt:CAGCATTTTCTTAGACCTCTTCAAA)%26(nt:ATGACCTTAGTTTATCACTCAGTAA)%26(nt:AGATATAAACCAGCTTCTTGGTATA)%26(nt:AGACCTCTTCAAACCAACTATTATT)%26(nt:ACAGTTAAAGTCTCCTGTCACATGA)%26(nt:AACTTTTAAGAGTCAGCATTTTCTT)%26(nt:AAACCAGCTTCTTGGTATAAATGAA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.272 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]