GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 22:55:39, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus splicing factor 1 (Sf1), transcript variant 2, mRNA. (2762 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 763 769 775 781 895 985 991 997 1003 1117 1123 1135 1165 1171 1177 1183
Synonym: Zfp162
NM_058210.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X8, mRNA. (2875 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_017588702.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X6, mRNA. (2875 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_006230647.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus splicing factor 1 (Sf1), transcript variant 1, mRNA. (3400 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 763 769 775 781 895 985 991 997 1003 1117 1123 1135 1165 1171 1177 1183
Synonym: Zfp162
NM_001110793.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X7, mRNA. (3076 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_008760066.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X5, mRNA. (3433 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 692 698 704 710 824 914 920 926 932 1046 1052 1064 1094 1100 1106 1112
Synonym: Zfp162
XM_006230646.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X2, mRNA. (3488 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_006230642.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X4, mRNA. (3504 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_006230645.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X1, mRNA. (3509 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_006230641.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X3, mRNA. (3513 bp)
cgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagagg...
position 768 774 780 786 900 990 996 1002 1008 1122 1128 1140 1170 1176 1182 1188
Synonym: Zfp162
XM_006230643.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/AF079873_at
lang : en | div : | spe : rn | query_string : AF079873_at | format : html | download :

0.000 | 0.000 | search_start;
0.086 | 0.086 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGAGACCCTGGCAGAGCTCAGAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGAATGGCACTCTACGGGAAGATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.111 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATTACAAGCCTCCAGCAACACGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.122 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGAACCTCTTCATGCTCTAGTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.133 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGTTAGCTCGCTTGAATGGCACTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.144 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGCAACGCCAAGATCATGATAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCGAGAGTTAGCTCGCTTGAATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.164 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTAGTCACTGCCAATACAATGGAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.176 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGCAGATTACAAGCCTCCAGCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.185 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTCTTCATGCTCTAGTCACTGCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.540 | 0.355 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCTGGCAGAGCTCAGAGACACGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.549 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGCAACACGTGTGAGCGATAAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.558 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATGCTCTAGTCACTGCCAATACAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.567 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGAGCTCAGAGACACGAAGCATTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.578 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGATCTTGAGACCCTGGCAGAGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.587 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGCCTCCAGCAACACGTGTGAGCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
1.137 | 0.549 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGAGACCCTGGCAGAGCTCAGAGA)%26(nt:TTGAATGGCACTCTACGGGAAGATG)%26(nt:GATTACAAGCCTCCAGCAACACGTG)%26(nt:GATGAACCTCTTCATGCTCTAGTCA)%26(nt:GAGTTAGCTCGCTTGAATGGCACTC)%26(nt:GAATGCAACGCCAAGATCATGATAC)%26(nt:CTTCGAGAGTTAGCTCGCTTGAATG)%26(nt:CTAGTCACTGCCAATACAATGGAGA)%26(nt:CCTGCAGATTACAAGCCTCCAGCAA)%26(nt:CCTCTTCATGCTCTAGTCACTGCCA)%26(nt:CCCTGGCAGAGCTCAGAGACACGAA)%26(nt:CCAGCAACACGTGTGAGCGATAAAG)%26(nt:CATGCTCTAGTCACTGCCAATACAA)%26(nt:CAGAGCTCAGAGACACGAAGCATTA)%26(nt:AGGATCTTGAGACCCTGGCAGAGCT)%26(nt:AAGCCTCCAGCAACACGTGTGAGCG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
1.146 | 0.009 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]