GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:55:04, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus C-terminal binding protein 1 (Ctbp1), mRNA. (2420 bp)
gttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattatt
position 1905 1915 1931 1997 2051 2075 2084 2116 2200 2218 2248 2271 2281 2324 2333 2344
Synonym: 50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS
NM_019201.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus C-terminal binding protein 1 (Ctbp1), transcript variant X4, mRNA. (2150 bp)
gttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattattttaaag...
position 1602 1612 1628 1694 1748 1772 1781 1813 1897 1915 1945 1968 1978 2021 2030 2041
Synonym: 50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS
XM_006251227.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus C-terminal binding protein 1 (Ctbp1), transcript variant X2, mRNA. (2228 bp)
gttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattattttaaag...
position 1680 1690 1706 1772 1826 1850 1859 1891 1975 1993 2023 2046 2056 2099 2108 2119
Synonym: 50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS
XM_006251226.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus C-terminal binding protein 1 (Ctbp1), transcript variant X1, mRNA. (2230 bp)
gttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattattttaaag...
position 1682 1692 1708 1774 1828 1852 1861 1893 1977 1995 2025 2048 2058 2101 2110 2121
Synonym: 50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS
XM_006251225.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus C-terminal binding protein 1 (Ctbp1), transcript variant X3, mRNA. (2339 bp)
gttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattattttaaag...
position 1791 1801 1817 1883 1937 1961 1970 2002 2086 2104 2134 2157 2167 2210 2219 2230
Synonym: 50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS
XM_017599147.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus C-terminal binding protein 1 (Ctbp1), transcript variant X6, mRNA. (2376 bp)
gttgattgtagttgtcccgtcctgtgggctggctcactgtcctgtgtcctttgcgttcctcgtttaagcaaaagaagttagtagctaattctatcacgaatgttcttgtctgtgtacagtttttagaacattaccaaggatttgtttgcttagctgtcaacaaaaagaaaacctgagggagcattcagcaagtcagtttgagattatttttccttttctacgttggaacgtgccccggaatgtggccgtcggcacacttctcaggacaatgaatccttcctgtttttctttttatgccacacagtgcattgtttttctatctgcttgtcttatttttagaataatttagaaaaacaacaaaggctgtttttcctaattttggcatgaaccccttgttccaaatgaagacggcatcgcgagtggctctgaggtgtgtctgcagtgcccagtgtgctcaggaccatcggggtctgtcctggggaaggcaggggttggcagacccttgcctacgtggtgccgtcctgctgatgtggtaggctagcaatattttggttaaaatcatgtttgtgactgtaaccatttgtatgaattattttaaag...
position 1828 1838 1854 1920 1974 1998 2007 2039 2123 2141 2171 2194 2204 2247 2256 2267
Synonym: 50-kDaBFA-inducedADP-ribosylatedsubstrate; Bars; BARS-50; CtBP3/BARS
XM_006251229.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/AF067795_g_at
lang : en | div : | spe : rn | query_string : AF067795_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTTATGCCACACAGTGCATTGTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.101 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTCAGGACAATGAATCCTTCCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.113 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTATCACGAATGTTCTTGTCTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.123 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGGCACACTTCTCAGGACAATGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.134 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGGACCATCGGGGTCTGTCCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.144 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAGTAGCTAATTCTATCACGAATGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.156 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAATTTTGGCATGAACCCCTTGTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.167 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTCTGAGGTGTGTCTGCAGTGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.179 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACGTGCCCCGGAATGTGGCCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.189 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCCTTGCCTACGTGGTGCCGTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.200 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGTTCCAAATGAAGACGGCATCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.210 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGTCTGTGTACAGTTTTTAGAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.220 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTACGTGGTGCCGTCCTGCTGATGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.233 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTCCTGCTGATGTGGTAGGCTAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.242 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAGTGTGCTCAGGACCATCGGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.252 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCTGAGGGAGCATTCAGCAAGTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.332 | 0.080 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTTATGCCACACAGTGCATTGTTT)%26(nt:TTCTCAGGACAATGAATCCTTCCTG)%26(nt:TTCTATCACGAATGTTCTTGTCTGT)%26(nt:TCGGCACACTTCTCAGGACAATGAA)%26(nt:TCAGGACCATCGGGGTCTGTCCTGG)%26(nt:TAGTAGCTAATTCTATCACGAATGT)%26(nt:TAATTTTGGCATGAACCCCTTGTTC)%26(nt:GGCTCTGAGGTGTGTCTGCAGTGCC)%26(nt:GGAACGTGCCCCGGAATGTGGCCGT)%26(nt:GACCCTTGCCTACGTGGTGCCGTCC)%26(nt:CTTGTTCCAAATGAAGACGGCATCG)%26(nt:CTTGTCTGTGTACAGTTTTTAGAAC)%26(nt:CTACGTGGTGCCGTCCTGCTGATGT)%26(nt:CGTCCTGCTGATGTGGTAGGCTAGC)%26(nt:CCCAGTGTGCTCAGGACCATCGGGG)%26(nt:ACCTGAGGGAGCATTCAGCAAGTCA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.338 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]