GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:15:37, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus BCL2 like 11 (Bcl2l11), mRNA. (5091 bp)
ctcagggcccgctggccccaccggccagccctggtccttttgctaccagatccccacttttcatctttgtgagaagatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttccgtctggtctggagaaggcactgacaggagcttcgtgcagccaggacaaatggcggacatcgctcttgttcagaccgggagaaccccagcacctccatctcttggcgctgcgacagtccggccggtggctctgtcccagagaggcgtgcggagcacggacagcgctcagcactgtgtcgatgtggacggaacctctgtc...
position 645 683 686 689 692 698 712 714 730 757 760 763 768 790 796 799 802 805 808 811
Synonym: Bim; BimL; Bod
NM_171988.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus BCL2 like 11 (Bcl2l11), transcript variant X3, mRNA. (4954 bp)
tcccttgccttctcggtggctacgtgcaggggtcgtccgatcggcacaacacgctgcgctccgaagggaaggggcggacaaaaaaagaccaaatggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccagctcaggcctggggcccctacctccctacagacagaatcgcaagcttccataaggcagtctcaggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttccgtctggtctggagaaggcactgacaggagcttcgtgcagccaggacaaatggcggacatcgctcttgttcagaccgggagaaccccagcacctccatctcttggcgctgcgacagtccggccggtggctctgtcccagagaggcgtgcggagcacggacagcgctcagcactgtgtcgatgtggacggaacctctgtc...
position 508 546 549 552 555 561 575 577 593 620 623 626 631 653 659 662 665 668 671 674
Synonym: Bim; BimL
XM_006234987.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus BCL2 like 11 (Bcl2l11), transcript variant X2, mRNA. (5044 bp)
aaatggccaagcaaccttctgatgtaaattctgagtgtgacagagaaggtggacaattgcagcctgctgagaggcctccccagctcaggcctggggcccctacctccctacagacagaatcgcaagacaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttccgtctggtctggagaaggcactgacaggagcttcgtgcagccaggacaaatggcggacatcgctcttgttcagaccgggagaaccccagcacctccatctcttggcgctgcgacagtccggccggtggctctgtcccagagaggcgtgcggagcacggacagcgctcagcactgtgtcgatgtggacggaacctctgtc...
position 598 636 639 642 645 651 665 667 683 710 713 716 721 743 749 752 755 758 761 764
Synonym: Bim; BimL
XM_006234985.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus BCL2 like 11 (Bcl2l11), transcript variant X1, mRNA. (5212 bp)
ctcagggcccgctggccccaccggccagccctggtccttttgctaccagatccccacttttcatctttgtgagaagatcttctctgctgtcccggtcctccagtgggtatttctcttttgacacagacaggagcccggcacccatgagttgtgacaagtcaacacaaaccccaagtcctccttgccaggccttcaaccattatctcagtgcaatggcttccataaggcagtctcaggaggaacctgaagatctgcgcccagagatacggatcgcacaggagctgcggcggatcggagacgagttcaatgagacttacacgaggagggcgtttgcaaacgattaccgagaggcggaagaccacccgcaaatggttatcttacaactgttacgattcatcttccgtctggtctggagaaggcactgacaggagcttcgtgcagccaggacaaatggcggacatcgctcttgttcagaccgggagaaccccagcacctccatctcttggcgctgcgacagtccggccggtggctctgtcccagagaggcgtgcggagcacggacagcgctcagcactgtgtcgatgtggacggaacctctgtc...
position 766 804 807 810 813 819 833 835 851 878 881 884 889 911 917 920 923 926 929 932
Synonym: Bim; BimL
XM_006234983.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/AF065433_g_at
lang : en | div : | spe : rn | query_string : AF065433_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCAAACGATTACCGAGAGGCGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.102 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATCTTACAACTGTTACGATTCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.112 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGTTATCTTACAACTGTTACGATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.123 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCGGCGGATCGGAGACGAGTTCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.134 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTTACAACTGTTACGATTCATCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.144 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACAACTGTTACGATTCATCTTCCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTTCCATAAGGCAGTCTCAGGAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.163 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGCCCAGAGATACGGATCGCACAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.174 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATTACCGAGAGGCGGAAGACCACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.186 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCGCACAGGAGCTGCGGCGGATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.199 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATACGGATCGCACAGGAGCTGCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.209 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTTTGCAAACGATTACCGAGAGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.220 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGCGGATCGGAGACGAGTTCAATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.231 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAGAGATACGGATCGCACAGGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.240 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAAACGATTACCGAGAGGCGGAAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.250 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTTCAATGAGACTTACACGAGGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.260 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAGATACGGATCGCACAGGAGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.270 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCCGCAAATGGTTATCTTACAACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.281 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTGTTACGATTCATCTTCCGTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.291 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAATGGTTATCTTACAACTGTTACG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.349 | 0.058 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGCAAACGATTACCGAGAGGCGGA)%26(nt:TTATCTTACAACTGTTACGATTCAT)%26(nt:TGGTTATCTTACAACTGTTACGATT)%26(nt:TGCGGCGGATCGGAGACGAGTTCAA)%26(nt:TCTTACAACTGTTACGATTCATCTT)%26(nt:TACAACTGTTACGATTCATCTTCCG)%26(nt:GCTTCCATAAGGCAGTCTCAGGAGG)%26(nt:GCGCCCAGAGATACGGATCGCACAG)%26(nt:GATTACCGAGAGGCGGAAGACCACC)%26(nt:GATCGCACAGGAGCTGCGGCGGATC)%26(nt:GATACGGATCGCACAGGAGCTGCGG)%26(nt:CGTTTGCAAACGATTACCGAGAGGC)%26(nt:CGGCGGATCGGAGACGAGTTCAATG)%26(nt:CCCAGAGATACGGATCGCACAGGAG)%26(nt:CAAACGATTACCGAGAGGCGGAAGA)%26(nt:AGTTCAATGAGACTTACACGAGGAG)%26(nt:AGAGATACGGATCGCACAGGAGCTG)%26(nt:ACCCGCAAATGGTTATCTTACAACT)%26(nt:AACTGTTACGATTCATCTTCCGTCT)%26(nt:AAATGGTTATCTTACAACTGTTACG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.354 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]