GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-10-17 14:50:26, GGRNA : RefSeq release 207 (Jul, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus stathmin 4 (Stmn4), transcript variant 4, mRNA. (1277 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 749 761 763 770 773 787 791 793 796 799 801 819 825 827 862 868
Synonym: Lagl; Rb3
NM_001270857.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus stathmin 4 (Stmn4), transcript variant 3, mRNA. (1280 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 752 764 766 773 776 790 794 796 799 802 804 822 828 830 865 871
Synonym: Lagl; Rb3
NM_001270856.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus stathmin 4 (Stmn4), transcript variant 5, mRNA. (1333 bp)
aggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggagccgcctgctgcgcggtgactcccgggaccgatcggtggcctcgtcccatggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 805 817 819 826 829 843 847 849 852 855 857 875 881 883 918 924
Synonym: Lagl; Rb3
NM_001270858.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus stathmin 4 (Stmn4), transcript variant 6, mRNA. (1345 bp)
aggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggagccgcctgctgcgcggtgactcccgggaccgatcggtggcctcgtcccatggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 817 829 831 838 841 855 859 861 864 867 869 887 893 895 930 936
Synonym: Lagl; Rb3
NM_001270859.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus stathmin 4 (Stmn4), transcript variant 1, mRNA. (1361 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 833 845 847 854 857 871 875 877 880 883 885 903 909 911 946 952
Synonym: Lagl; Rb3
NM_019176.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus stathmin 4 (Stmn4), transcript variant X2, mRNA. (1404 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 877 889 891 898 901 915 919 921 924 927 929 947 953 955 990 996
Synonym: Lagl; Rb3
XM_006252151.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus stathmin 4 (Stmn4), transcript variant X5, mRNA. (1405 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 878 890 892 899 902 916 920 922 925 928 930 948 954 956 991 997
Synonym: Lagl; Rb3
XM_039093679.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus stathmin 4 (Stmn4), transcript variant X3, mRNA. (1408 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 881 893 895 902 905 919 923 925 928 931 933 951 957 959 994 1000
Synonym: Lagl; Rb3
XM_039093678.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus stathmin 4 (Stmn4), transcript variant X4, mRNA. (1409 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 882 894 896 903 906 920 924 926 929 932 934 952 958 960 995 1001
Synonym: Lagl; Rb3
XM_008770778.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus stathmin 4 (Stmn4), transcript variant 2, mRNA. (1414 bp)
aggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggagccgcctgctgcgcggtgactcccgggaccgatcggtggcctcgtcccatggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 886 898 900 907 910 924 928 930 933 936 938 956 962 964 999 1005
Synonym: Lagl; Rb3
NM_001270855.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus stathmin 4 (Stmn4), transcript variant X1, mRNA. (1514 bp)
acaccttgcagagaaacgagagcatgagcgtgaggtaatccagaaagctatcgaggaaaacaacaacttcatcaagatggcgaaagagaagctggcccagaagatggagtccaataaggaaaaccgggaggcccatctggctgccatgttggagcggctgcaagagaaggacaagcacgcagaggaggtgcggaaaaacaaggagctgaaggaagaggcctccaggtaaagcccagaggccaaggaagtttccaggacagccggacagctcccgcagcaacctggttccagcagcatcggccgctggctgctctcccagcactggggttcggggggaggggggtggccaaaggggcgtttcctctgcttttggtgtttgtacatgtaaaagattgaccagtgaagccatcctatttgtttctggggaacaatgatggggtgggagaggggacagagagtgtgtggaaaaggaggtgaagatgagcccgaggactttgtgacactgtccactgactgcagacttgggccaaggcccccgcttttcacggctctgcctggacattcggcctccaggttcctagtggagagaagatgtgacag...
position 987 999 1001 1008 1011 1025 1029 1031 1034 1037 1039 1057 1063 1065 1100 1106
Synonym: Lagl; Rb3
XM_039093677.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/AF026529_s_at
lang : en | div : | spe : rn | query_string : AF026529_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.097 | 0.097 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCGCAGCAACCTGGTTCCAGCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.110 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTTCCAGCAGCATCGGCCGCTGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.121 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCCAAAGGGGCGTTTCCTCTGCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.131 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAAGTTTCCAGGACAGCCGGACAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.143 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTCTCCCAGCACTGGGGTTCGGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.354 | 0.211 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGCAACCTGGTTCCAGCAGCATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.370 | 0.016 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACAGCCGGACAGCTCCCGCAGCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.380 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGTTCCAGCAGCATCGGCCGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.392 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCTCTCCCAGCACTGGGGTTCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.402 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTGGCTGCTCTCCCAGCACTGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.412 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCAGAGGCCAAGGAAGTTTCCAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.423 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGGACAGCCGGACAGCTCCCGCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.434 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGGGCGTTTCCTCTGCTTTTGGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.444 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCAACCTGGTTCCAGCAGCATCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.455 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTTTCCAGGACAGCCGGACAGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.745 | 0.290 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCTGGTTCCAGCAGCATCGGCCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.849 | 0.105 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCCGCAGCAACCTGGTTCCAGCAG)%26(nt:GGTTCCAGCAGCATCGGCCGCTGGC)%26(nt:GGCCAAAGGGGCGTTTCCTCTGCTT)%26(nt:GGAAGTTTCCAGGACAGCCGGACAG)%26(nt:GCTCTCCCAGCACTGGGGTTCGGGG)%26(nt:GCAGCAACCTGGTTCCAGCAGCATC)%26(nt:GACAGCCGGACAGCTCCCGCAGCAA)%26(nt:CTGGTTCCAGCAGCATCGGCCGCTG)%26(nt:CTGCTCTCCCAGCACTGGGGTTCGG)%26(nt:CGCTGGCTGCTCTCCCAGCACTGGG)%26(nt:CCCAGAGGCCAAGGAAGTTTCCAGG)%26(nt:CAGGACAGCCGGACAGCTCCCGCAG)%26(nt:AGGGGCGTTTCCTCTGCTTTTGGTG)%26(nt:AGCAACCTGGTTCCAGCAGCATCGG)%26(nt:AAGTTTCCAGGACAGCCGGACAGCT)%26(nt:AACCTGGTTCCAGCAGCATCGGCCG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.859 | 0.010 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]