GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:49:44, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus beaded filament structural protein 1 (Bfsp1), mRNA. (2132 bp)
gagccctctcctggacagcccatgccacctgtggagaatggtcagggggttccccagggcagggaaggtgcccactcaaaccatcaacaggttacagacaagaatgggataagagccaaggaaccgaaagatctggaggaaaaagatgatgacagcaggaaggacgatgaggcgggcaggagaccctgtcctgtgatcatacctggtcctgatggaccatctacgacccattcacaaacgtctgggtccaatcagggtggaccagaggggcctgggagtaagagcagtagcctgctggccaagagcccttcgaaggctttgtcttttaagaaggtagaggtggtggaatccattgagaagatttcgacagagagtattcagacgtatgaagaaacttctgtaattgtggagacggtgattgggaagacaaagggtaacaagaaaccgggagagaagagctcctcaaatgccaaggcttgaaggaagagagtgtctggggccagtaggggaagtgctttgagatagcttcctgtttggattagatcatagttgacctgtctggcggacgaccttcattaaactgctttatttttgcttgca...
position 1549 1591 1597 1603 1711 1717 1723 1729 1741 1747 1807 1921 1981 2047 2053 2083
Synonym: 115-kDa; CP94; CP95; CP97
NM_031555.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus beaded filament structural protein 1 (Bfsp1), transcript variant X1, mRNA. (2094 bp)
gagccctctcctggacagcccatgccacctgtggagaatggtcagggggttccccagggcagggaaggtgcccactcaaaccatcaacaggttacagacaagaatgggataagagccaaggaaccgaaagatctggaggaaaaagatgatgacagcaggaaggacgatgaggcgggcaggagaccctgtcctgtgatcatacctggtcctgatggaccatctacgacccattcacaaacgtctgggtccaatcagggtggaccagaggggcctgggagtaagagcagtagcctgctggccaagagcccttcgaaggctttgtcttttaagaaggtagaggtggtggaatccattgagaagatttcgacagagagtattcagacgtatgaagaaacttctgtaattgtggagacggtgattgggaagacaaagggtaacaagaaaccgggagagaagagctcctcaaatgccaaggcttgaaggaagagagtgtctggggccagtaggggaagtgctttgagatagcttcctgtttggattagatcatagttgacctgtctggcggacgaccttcattaaactgctttatttttgcttgca...
position 1511 1553 1559 1565 1673 1679 1685 1691 1703 1709 1769 1883 1943 2009 2015 2045
Synonym: 115-kDa; CP94; CP95; CP97
XM_006235117.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus beaded filament structural protein 1 (Bfsp1), transcript variant X2, mRNA. (3082 bp)
gagccctctcctggacagcccatgccacctgtggagaatggtcagggggttccccagggcagggaaggtgcccactcaaaccatcaacaggttacagacaagaatgggataagagccaaggaaccgaaagatctggaggaaaaagatgatgacagcaggaaggacgatgaggcgggcaggagaccctgtcctgtgatcatacctggtcctgatggaccatctacgacccattcacaaacgtctgggtccaatcagggtggaccagaggggcctgggagtaagagcagtagcctgctggccaagagcccttcgaaggctttgtcttttaagaaggtagaggtggtggaatccattgagaagatttcgacagagagtattcagacgtatgaagaaacttctgtaattgtggagacggtgattgggaagacaaagggtaacaagaaaccgggagagaagagctcctcaaatgccaaggcttgaaggaagagagtgtctggggccagtaggggaagtgctttgagatagcttcctgtttggattagatcatagttgacctgtctggcggacgaccttcattaaactgctttatttttgcttgca...
position 2499 2541 2547 2553 2661 2667 2673 2679 2691 2697 2757 2871 2931 2997 3003 3033
Synonym: 115-kDa; CP94; CP95; CP97
XM_017591490.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/AB003104_at
lang : en | div : | spe : rn | query_string : AB003104_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCTGGCGGACGACCTTCATTAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.102 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTACGACCCATTCACAAACGTCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.112 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAAACCATCAACAGGTTACAGACA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.122 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACCATCTACGACCCATTCACAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.132 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCCACTCAAACCATCAACAGGTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.144 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAGGTGCCCACTCAAACCATCAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTCCTGTTTGGATTAGATCATAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.166 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGTGATCATACCTGGTCCTGATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.176 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGGTCCTGATGGACCATCTACGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.186 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCTGTCCTGTGATCATACCTGGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.196 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGCCACCTGTGGAGAATGGTCAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.206 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCATACCTGGTCCTGATGGACCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.215 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATAGCTTCCTGTTTGGATTAGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTTCTGTAATTGTGGAGACGGTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.235 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGAGCTCCTCAAATGCCAAGGCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.293 | 0.058 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGAGCAGTAGCCTGCTGGCCAAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.334 | 0.041 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCTGGCGGACGACCTTCATTAAA)%26(nt:TCTACGACCCATTCACAAACGTCTG)%26(nt:TCAAACCATCAACAGGTTACAGACA)%26(nt:GGACCATCTACGACCCATTCACAAA)%26(nt:GCCCACTCAAACCATCAACAGGTTA)%26(nt:GAAGGTGCCCACTCAAACCATCAAC)%26(nt:CTTCCTGTTTGGATTAGATCATAGT)%26(nt:CCTGTGATCATACCTGGTCCTGATG)%26(nt:CCTGGTCCTGATGGACCATCTACGA)%26(nt:CCCTGTCCTGTGATCATACCTGGTC)%26(nt:ATGCCACCTGTGGAGAATGGTCAGG)%26(nt:ATCATACCTGGTCCTGATGGACCAT)%26(nt:AGATAGCTTCCTGTTTGGATTAGAT)%26(nt:ACTTCTGTAATTGTGGAGACGGTGA)%26(nt:AAGAGCTCCTCAAATGCCAAGGCTT)%26(nt:AAGAGCAGTAGCCTGCTGGCCAAGA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.337 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]