2024-05-08 03:16:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_015778094 990 bp mRNA linear PLN 07-AUG-2018 DEFINITION PREDICTED: Oryza sativa Japonica Group sm-like protein LSM1B (LOC4335963), mRNA. ACCESSION XM_015778094 VERSION XM_015778094.2 DBLINK BioProject: PRJNA122 KEYWORDS RefSeq. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_029259.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process On Aug 7, 2018 this sequence version replaced XM_015778094.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Name :: Oryza sativa Japonica Group Annotation Release 102 Annotation Version :: 102 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 8.1 Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..990 /organism="Oryza sativa Japonica Group" /mol_type="mRNA" /cultivar="Nipponbare" /db_xref="taxon:39947" /chromosome="4" gene 1..990 /gene="LOC4335963" /note="Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 3 mRNAs, 36 ESTs, 12 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 118 samples with support for all annotated introns" /db_xref="GeneID:4335963" CDS 235..624 /gene="LOC4335963" /codon_start=1 /product="sm-like protein LSM1B" /protein_id="XP_015633580.1" /db_xref="GeneID:4335963" /translation="
MSSWAGPDEIFLSTSLAGFLDKKLIVLLRDGRKLLGTLCSFDQFANVVLQGACERVIVGELYCDVPLGLYVIRGENVVLIGELDREKDELPAHMTCVSEAEIRKAEKAEREARDLKGSMRKRMEFLDFD"
misc_feature 271..483 /gene="LOC4335963" /note="Like-Sm protein 1; Region: LSm1; cd01728" /db_xref="CDD:212475" misc_feature order(280..282,289..294,307..309,313..321,328..330, 334..336,349..360,367..372,376..378,439..477) /gene="LOC4335963" /note="putative oligomer interface [polypeptide binding]; other site" /db_xref="CDD:212475" misc_feature order(304..324,328..366,370..384) /gene="LOC4335963" /note="Sm1 motif; other site" /db_xref="CDD:212475" misc_feature order(358..360,364..366,451..453) /gene="LOC4335963" /note="putative RNA binding site [nucleotide binding]; other site" /db_xref="CDD:212475" misc_feature 439..474 /gene="LOC4335963" /note="Sm2 motif; other site" /db_xref="CDD:212475" ORIGIN
caactgcgtcaacctcacacttgacgatagttcctttcatcaatcacccagctttactcctcttctccccccgccccgcttcaccaatcaatccaaaccctagagcaaatcccctccctcccttgccggaatcgctcgcaagctccaggcagcccccacaccagtccgcggcggatcagggggcggggcgatctctagcgccctccgggatttgaagggttccgagcgtcggcgatgtcgtcgtgggccgggcccgacgagatcttcctctccacgtccctggccggcttcttggacaagaaacttattgtcctactacgagatggacggaagctgcttggcacactctgctcatttgatcagtttgcaaatgttgttcttcagggtgcttgtgaacgagtaattgtaggtgaactatattgtgatgttcctcttggtctatatgtgatccggggagagaatgtcgtattaatcggagaattggatcgtgagaaggatgaactccctgctcacatgacttgtgtttcagaggctgaaataagaaaggccgagaaagcagaaagggaagcgagagatctgaaaggttcaatgaggaagaggatggagttcttagactttgattagaatggatttgaccatcttgatagttgctgctcccactatggccgcgagtttttaatggcagcctctgctacatatgtgggctaatgaaagccagatttcgttgtatctcatgctgcttgttcagccagaattcttcaggttggagatttcagtaaacatactcttttacagcggtaatgtacctgtgttcttaaaatttcttcagatatcttcctgtcctcttgttgcatggaatttgtgaaatttccttcgccaccataccctccgttttcgctgtcacattgtccgctaaaatcaatcttcaacttgccatctttggatggaatgacagtgcttggcatattggcatttgatgtgtaaacttaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]