2024-06-14 18:49:52, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_009095 733 bp mRNA linear ROD 10-APR-2024 DEFINITION Mus musculus ribosomal protein S5 (Rps5), transcript variant 2, mRNA. ACCESSION NM_009095 VERSION NM_009095.3 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 733) AUTHORS Li,H., Huo,Y., He,X., Yao,L., Zhang,H., Cui,Y., Xiao,H., Xie,W., Zhang,D., Wang,Y., Zhang,S., Tu,H., Cheng,Y., Guo,Y., Cao,X., Zhu,Y., Jiang,T., Guo,X., Qin,Y. and Sha,J. TITLE A male germ-cell-specific ribosome controls male fertility JOURNAL Nature 612 (7941), 725-731 (2022) PUBMED 36517592 REFERENCE 2 (bases 1 to 733) AUTHORS Harnett,D., Ambrozkiewicz,M.C., Zinnall,U., Rusanova,A., Borisova,E., Drescher,A.N., Couce-Iglesias,M., Villamil,G., Dannenberg,R., Imami,K., Munster-Wandowski,A., Fauler,B., Mielke,T., Selbach,M., Landthaler,M., Spahn,C.M.T., Tarabykin,V., Ohler,U. and Kraushar,M.L. TITLE A critical period of translational control during brain development at codon resolution JOURNAL Nat Struct Mol Biol 29 (12), 1277-1290 (2022) PUBMED 36482253 REFERENCE 3 (bases 1 to 733) AUTHORS Zhang,M., Chen,D., Xia,J., Han,W., Cui,X., Neuenkirchen,N., Hermes,G., Sestan,N. and Lin,H. TITLE Post-transcriptional regulation of mouse neurogenesis by Pumilio proteins JOURNAL Genes Dev 31 (13), 1354-1369 (2017) PUBMED 28794184 REFERENCE 4 (bases 1 to 733) AUTHORS Vizirianakis,I.S., Papachristou,E.T., Andreadis,P., Zopounidou,E., Matragkou,C.N. and Tsiftsoglou,A.S. TITLE Genetic manipulation of RPS5 gene expression modulates the initiation of commitment of MEL cells to erythroid maturation: Implications in understanding ribosomopathies JOURNAL Int J Oncol 47 (1), 303-314 (2015) PUBMED 25998414 REMARK GeneRIF: Findings support the concept that genetic manipulation of RPS5 gene expression level (up- and/or downregulation) critically affects the potential of murine erythroleukemia cells to fully complete their erythroid maturation program in vitro. REFERENCE 5 (bases 1 to 733) AUTHORS Khatter,H., Myasnikov,A.G., Natchiar,S.K. and Klaholz,B.P. TITLE Structure of the human 80S ribosome JOURNAL Nature 520 (7549), 640-645 (2015) PUBMED 25901680 REFERENCE 6 (bases 1 to 733) AUTHORS Stryke,D., Kawamoto,M., Huang,C.C., Johns,S.J., King,L.A., Harper,C.A., Meng,E.C., Lee,R.E., Yee,A., L'Italien,L., Chuang,P.T., Young,S.G., Skarnes,W.C., Babbitt,P.C. and Ferrin,T.E. TITLE BayGenomics: a resource of insertional mutations in mouse embryonic stem cells JOURNAL Nucleic Acids Res 31 (1), 278-281 (2003) PUBMED 12520002 REFERENCE 7 (bases 1 to 733) AUTHORS Reymond,A., Marigo,V., Yaylaoglu,M.B., Leoni,A., Ucla,C., Scamuffa,N., Caccioppoli,C., Dermitzakis,E.T., Lyle,R., Banfi,S., Eichele,G., Antonarakis,S.E. and Ballabio,A. TITLE Human chromosome 21 gene expression atlas in the mouse JOURNAL Nature 420 (6915), 582-586 (2002) PUBMED 12466854 REFERENCE 8 (bases 1 to 733) AUTHORS Pfisterer,P., Ehlermann,J., Hegen,M. and Schorle,H. TITLE A subtractive gene expression screen suggests a role of transcription factor AP-2 alpha in control of proliferation and differentiation JOURNAL J Biol Chem 277 (8), 6637-6644 (2002) PUBMED 11741941 REFERENCE 9 (bases 1 to 733) AUTHORS Vizirianakis,I.S., Pappas,I.S., Gougoumas,D. and Tsiftsoglou,A.S. TITLE Expression of ribosomal protein S5 cloned gene during differentiation and apoptosis in murine erythroleukemia (MEL) cells JOURNAL Oncol Res 11 (9), 409-419 (1999) PUBMED 10821535 REFERENCE 10 (bases 1 to 733) AUTHORS Vanegas,N., Castaneda,V., Santamaria,D., Hernandez,P., Schvartzman,J.B. and Krimer,D.B. TITLE Cloning, sequencing and expression in MEL cells of a cDNA encoding the mouse ribosomal protein S5 JOURNAL Biochim Biophys Acta 1357 (1), 1-4 (1997) PUBMED 9202169 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC107704.8. On Mar 1, 2023 this sequence version replaced NM_009095.2. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: CA461462.1, CA787280.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849374, SAMN00849375 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on conservation, expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-71 AC107704.8 141288-141358 72-180 AC107704.8 141943-142051 181-390 AC107704.8 144362-144571 391-519 AC107704.8 144707-144835 520-618 AC107704.8 145366-145464 619-733 AC107704.8 145542-145656 FEATURES Location/Qualifiers source 1..733 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 7.69 cM" gene 1..733 /gene="Rps5" /note="ribosomal protein S5" /db_xref="GeneID:20103" /db_xref="MGI:MGI:1097682" exon 1..71 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 72..180 /gene="Rps5" /inference="alignment:Splign:2.1.0" CDS 73..687 /gene="Rps5" /note="40S ribosomal protein S5; S5 ribosomal protein" /codon_start=1 /product="small ribosomal subunit protein uS7" /protein_id="NP_033121.2" /db_xref="CCDS:CCDS20817.1" /db_xref="GeneID:20103" /db_xref="MGI:MGI:1097682" /translation="
MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
misc_feature 73..75 /gene="Rps5" /note="N-acetylmethionine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); acetylation site" misc_feature 76..78 /gene="Rps5" /note="N-acetylthreonine, in 40S ribosomal protein S5, N-terminally processed. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); acetylation site" misc_feature 112..114 /gene="Rps5" /note="Phosphothreonine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); phosphorylation site" misc_feature 124..684 /gene="Rps5" /note="Eukaryota homolog of Ribosomal Protein S7; Region: uS7_Eukaryote; cd14867" /db_xref="CDD:271246" misc_feature order(124..126,211..219,223..234,331..333,343..345) /gene="Rps5" /note="S9 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature 211..213 /gene="Rps5" /note="N6-acetyllysine, alternate. /evidence=ECO:0007744|PubMed:23806337; propagated from UniProtKB/Swiss-Prot (P97461.4); acetylation site" misc_feature order(223..225,229..231,241..252,259..261,283..285, 292..294,298..312,322..336,343..345,463..471,475..477, 505..507,526..528,547..549,556..558,574..579) /gene="Rps5" /note="rRNA binding site [nucleotide binding]; other site" /db_xref="CDD:271246" misc_feature order(355..357,364..369,376..378,574..576,580..585) /gene="Rps5" /note="S25 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature order(460..462,469..471,475..477,682..684) /gene="Rps5" /note="S11 interface [polypeptide binding]; other site" /db_xref="CDD:271246" misc_feature 496..498 /gene="Rps5" /note="Phosphoserine. /evidence=ECO:0000250|UniProtKB:P46782; propagated from UniProtKB/Swiss-Prot (P97461.4); phosphorylation site" exon 181..390 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 391..519 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 520..618 /gene="Rps5" /inference="alignment:Splign:2.1.0" exon 619..733 /gene="Rps5" /inference="alignment:Splign:2.1.0" ORIGIN
ctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]