ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2024-06-14 22:46:46, GGRNA.v2 : RefSeq release 224 (May, 2024)
LOCUS NM_001312869 5583 bp mRNA linear ROD 23-APR-2024
DEFINITION Mus musculus transforming growth factor, beta receptor I (Tgfbr1),
transcript variant 3, mRNA.
ACCESSION NM_001312869
VERSION NM_001312869.2
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 5583)
AUTHORS Mohamed,F.E.Z.A., Dewidar,B., Lin,T., Ebert,M.P., Dooley,S.,
Meindl-Beinker,N.M. and Hammad,S.
TITLE TGFbetaR1 inhibition drives hepatocellular carcinoma proliferation
through induction of toll-like-receptor signalling
JOURNAL Int J Exp Pathol 105 (2), 64-74 (2024)
PUBMED 38328944
REMARK GeneRIF: TGFbetaR1 inhibition drives hepatocellular carcinoma
proliferation through induction of toll-like-receptor signalling.
REFERENCE 2 (bases 1 to 5583)
AUTHORS Lozovska,A., Korovesi,A.G., Dias,A., Lopes,A., Fowler,D.A.,
Martins,G.G., Novoa,A. and Mallo,M.
TITLE Tgfbr1 controls developmental plasticity between the hindlimb and
external genitalia by remodeling their regulatory landscape
JOURNAL Nat Commun 15 (1), 2509 (2024)
PUBMED 38509075
REMARK GeneRIF: Tgfbr1 controls developmental plasticity between the
hindlimb and external genitalia by remodeling their regulatory
landscape.
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 5583)
AUTHORS Bedolla,A.M., McKinsey,G.L., Ware,K., Santander,N., Arnold,T.D. and
Luo,Y.
TITLE A comparative evaluation of the strengths and potential caveats of
the microglial inducible CreER mouse models
JOURNAL Cell Rep 43 (1), 113660 (2024)
PUBMED 38217856
REFERENCE 4 (bases 1 to 5583)
AUTHORS Pluangnooch,P., Soontrapa,K., Pudgerd,A. and Sridurongrit,S.
TITLE Expression of constitutively active TbetaRI leads to attenuation of
ovalbumin-induced allergic airway inflammation associated with
augmented M2 polarization of alveolar macrophage
JOURNAL Respir Investig 62 (1), 90-97 (2024)
PUBMED 38007853
REMARK GeneRIF: Expression of constitutively active TbetaRI leads to
attenuation of ovalbumin-induced allergic airway inflammation
associated with augmented M2 polarization of alveolar macrophage.
REFERENCE 5 (bases 1 to 5583)
AUTHORS Alsamraae,M., Costanzo-Garvey,D., Teply,B.A., Boyle,S.,
Sommerville,G., Herbert,Z.T., Morrissey,C., Dafferner,A.J.,
Abdalla,M.Y., Fallet,R.W., Kielian,T., Jensen-Smith,H.,
deOliveira,E.I., Chen,K., Bettencourt,I.A., Wang,J.M.,
McVicar,D.W., Keeley,T., Yu,F. and Cook,L.M.
TITLE Androgen receptor inhibition suppresses anti-tumor neutrophil
response against bone metastatic prostate cancer via regulation of
TbetaRI expression
JOURNAL Cancer Lett 579, 216468 (2023)
PUBMED 37940068
REFERENCE 6 (bases 1 to 5583)
AUTHORS Iseki,S., Osumi-Yamashita,N., Miyazono,K., Franzen,P., Ichijo,H.,
Ohtani,H., Hayashi,Y. and Eto,K.
TITLE Localization of transforming growth factor-beta type I and type II
receptors in mouse development
JOURNAL Exp Cell Res 219 (2), 339-347 (1995)
PUBMED 7641785
REFERENCE 7 (bases 1 to 5583)
AUTHORS Roelen,B.A., Lin,H.Y., Knezevic,V., Freund,E. and Mummery,C.L.
TITLE Expression of TGF-beta s and their receptors during implantation
and organogenesis of the mouse embryo
JOURNAL Dev Biol 166 (2), 716-728 (1994)
PUBMED 7813789
REFERENCE 8 (bases 1 to 5583)
AUTHORS ten Dijke,P., Yamashita,H., Ichijo,H., Franzen,P., Laiho,M.,
Miyazono,K. and Heldin,C.H.
TITLE Characterization of type I receptors for transforming growth
factor-beta and activin
JOURNAL Science 264 (5155), 101-104 (1994)
PUBMED 8140412
REFERENCE 9 (bases 1 to 5583)
AUTHORS Suzuki,A., Shioda,N., Maeda,T., Tada,M. and Ueno,N.
TITLE A mouse TGF-beta type I receptor that requires type II receptor for
ligand binding
JOURNAL Biochem Biophys Res Commun 198 (3), 1063-1069 (1994)
PUBMED 8117262
REFERENCE 10 (bases 1 to 5583)
AUTHORS Tomoda,T., Kudoh,T., Noma,T., Nakazawa,A., Muramatsu,M. and Arai,K.
TITLE Molecular cloning of a mouse counterpart for human TGF-beta type I
receptor
JOURNAL Biochem Biophys Res Commun 198 (3), 1054-1062 (1994)
PUBMED 8117261
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AL772150.11.
On Oct 16, 2023 this sequence version replaced NM_001312869.1.
Summary: This gene encodes a member of the transforming growth
factor beta (TGF-beta) receptor family of proteins. These proteins
comprise one component of the TGF-beta signaling pathway, which
transduces extracellular signals into gene expression changes to
regulate a wide range of cellular responses, including
proliferation, migration, differentiation and apoptosis. Homozygous
knockout mice for this gene exhibit impaired angiogenesis and
embryonic lethality. Alternative splicing results in multiple
transcript variants. [provided by RefSeq, Aug 2015].
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK015337.1, SRR5189685.185800.1
[ECO:0000332]
RNAseq introns :: single sample supports all introns
SAMN00849384, SAMN01164134
[ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-255 AL772150.11 16336-16590
256-498 AL772150.11 23348-23590
499-729 AL772150.11 26456-26686
730-897 AL772150.11 32904-33071
898-1054 AL772150.11 33471-33627
1055-1179 AL772150.11 35630-35754
1180-1310 AL772150.11 37023-37153
1311-5583 AL772150.11 40753-45025
FEATURES Location/Qualifiers
source 1..5583
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="4"
/map="4 26.02 cM"
gene 1..5583
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="transforming growth factor, beta receptor I"
/db_xref="GeneID:21812"
/db_xref="MGI:MGI:98728"
exon 1..255
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
misc_feature 48..50
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="upstream in-frame stop codon"
CDS 174..1436
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/EC_number="2.7.11.30"
/note="isoform 3 is encoded by transcript variant 3;
TGF-beta receptor type-1; TGF-beta receptor type I;
transforming growth factor-beta receptor type I"
/codon_start=1
/product="TGF-beta receptor type-1 isoform 3"
/protein_id="NP_001299798.1"
/db_xref="CCDS:CCDS84729.1"
/db_xref="GeneID:21812"
/db_xref="MGI:MGI:98728"
/translation="
MDLKSLIMVMMEDYKDITPLKKLQENKGPFSEKQSAGLGPVELAAVIAGPVCFVCIALMLMVYICHNRTVIHHRVPNEEDPSLDRPFISEGTTLKDLIYDMTTSGSGSGLPLLVQRTIARTIVLQESIGKGRFGEVWRGKWRGEEVAVKIFSSREERSWFREAEIYQTVMLRHENILGFIAADNKDNGTWTQLWLVSDYHEHGSLFDYLNRYTVTVEGMIKLALSTASGLAHLHMEIVGTQGKPAIAHRDLKSKNILVKKNGTCCIADLGLAVRHDSATDTIDIAPNHRVGTKRYMAPEVLDDSINMKHFESFKRADIYAMGLVFWEIARRCSIGGIHEDYQLPYYDLVPSDPSVEEMRKVVCEQKLRPNIPNRWQSCEALRVMAKIMRECWYANGAARLTALRIKKTLSQLSQQEGIKM"
misc_feature 450..533
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Transforming growth factor beta type I GS-motif;
Region: TGF_beta_GS; pfam08515"
/db_xref="CDD:462503"
misc_feature 549..1412
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="Catalytic domain of the Serine/Threonine Kinases,
Transforming Growth Factor beta Type I Receptor and
Activin Type IB/IC Receptors; Region:
STKc_TGFbR1_ACVR1b_ACVR1c; cd14143"
/db_xref="CDD:271045"
misc_feature order(555..569,579..581,612..614,618..620,702..704,
762..773,783..785,789..791,921..923,927..929,933..938,
942..944,975..977,984..986,1044..1055)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="active site"
/db_xref="CDD:271045"
misc_feature order(555..575,579..581,612..614,618..620,762..767,
771..773,783..785,933..938,942..944,975..977)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:271045"
misc_feature order(567..569,783..785,789..791,921..923,927..929,
933..935,984..986,1044..1055)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="polypeptide substrate binding site [polypeptide
binding]; other site"
/db_xref="CDD:271045"
misc_feature order(648..653,660..665,672..677,717..719,723..725)
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="FKBP12 binding site [polypeptide binding]; other
site"
/db_xref="CDD:271045"
misc_feature 972..1055
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="activation loop (A-loop); other site"
/db_xref="CDD:271045"
exon 256..498
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 499..729
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 730..897
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 898..1054
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1055..1179
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1180..1310
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
exon 1311..5583
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/inference="alignment:Splign:2.1.0"
regulatory 5562..5567
/regulatory_class="polyA_signal_sequence"
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="hexamer: AATAAA"
polyA_site 5583
/gene="Tgfbr1"
/gene_synonym="Alk-5; ALK5; ESK2; TbetaR-I; TbetaRI;
TGFR-1"
/note="major polyA site"
ORIGIN
attacaggaaggacaggctccaatgagagggaagggagcacttgagataatcagatggcggaggcaatcataagaacagaaacaacagaaaccaaggttacttggcatcatcagaacccaattctcccaccacagcaagtcctggatacaccatcacaccagaaaagcaagatatggatctaaagtcacttatcatggtgatgatggaagactataaggatataactcccttaaagaaattacaggagaataaaggacctttttcagaaaagcagtcagctggccttggtcctgtggagctggcagctgtcattgctggtccagtctgcttcgtctgcattgcacttatgctgatggtctatatctgccataaccgcactgtcattcaccaccgtgtgccaaatgaagaggatccatcactagatcgccctttcatttcagagggcaccaccttaaaagatttaatttatgatatgacaacatcagggtctggatcaggtttaccactgcttgttcaaagaacaattgccaggaccattgtgttacaagaaagcattggcaaaggtcggtttggagaagtttggcgaggcaaatggcggggagaagaagttgctgtgaagatattctcttctagagaagagcgttcatggttccgagaggcagagatttatcagactgtaatgttacgccatgaaaatatcctgggatttatagcagcagacaacaaagacaatgggacatggacgcagctgtggttggtgtcagattatcatgagcatggatcccttttcgattacttgaatagatacactgttactgtggaaggaatgatcaagcttgctctgtccacagcaagtggtcttgcccatcttcacatggagattgttggtacccaaggaaaaccagctattgcccatagagatttgaaatcaaagaatatcttggtgaagaaaaatggaacctgttgtattgcagacttgggacttgctgtgagacatgattctgccacagatacaattgatattgctccaaaccacagagtaggcactaaaaggtacatggcccctgaagttctagatgattccataaatatgaaacattttgaatccttcaaacgcgctgacatctatgcaatgggcttagtgttctgggaaattgctcgacgctgttctattggtggaatccatgaagactatcagttgccttattatgatcttgtaccttctgatccatcggttgaagaaatgagaaaagtagtttgcgaacagaagttaaggccaaatattccaaacagatggcagagctgtgaggccttgagagtgatggctaaaattatgagagaatgctggtatgccaatggagcagcaaggctgacagctttgcgaattaaaaaaacattgtcacaactcagccaacaggaaggcatcaaaatgtaactgaaacaccgtgggaactctgctctcttcatatctgctcctgggtgtttaggaggctggttgttctacctcactgagagaacagagggctctgcttcctcttgcagcagtggaatatggtcaactgaaagcttcccagggtttctctgggcccagaggcagccgtggggtcctttctgtgcactatggatacttcttccagacagttacagaatgttgtgtagtctacttttgtttttattaacaaagcttgtttttaaagacaactgccagcccttagggagctgctgtgctgttgaccttctgtaagggtgaaggagctggggtgtggcactaaatgaagcacttctgattttcactcctagtagtacattctcagaggactctgaaccactagtgtttccttggttcactttgaatgtactgttctataatttttcaagatcttaaactaacactttaaactctatagtctaaaaaatatgacctcgtggaggcgtgggggcacagttgctccgttgtatttgtgcacagctccttcacactctgaacacaacacaccttcacagtagggttgtgctacaccagtaagtgctacttttgcatctgtctaagtggaaacgaacagaactacttaaaggcggtgttaagtcctgtatcattttcattcaaaaagtttatttttctgagtaacctaaaccttttctgggtttgtttttgttttttgagggtttttgtgatagatgtcattcagtcttcatgcctttctcctacccagatgtgcttgaaccactgaggcaaggctgtagcattgataagcagtgactgccatgcgggaacaccccacaggagcactggagctctgcagttgagacgtttagcctgagtttattttaagaagtgaagtggcactccaaacatgtacagtgctttatggatgtaatcattatggtatacagactccttttgaaaggggaggcttgtctattgccgaaggaaaagttgtatgctgttctgtaagccatttctttttctttatttgatcaaagcagtgttttgttttgttttgatttttcttttttggaaaggaattgcatttaaaattcaaatgtggttaatgttaaataataggcctttttctaggaaggcagatatagttaatatgaatgtacaagtgtaggtgactttcacatgttatgtagctgtaagtatttgtggattctatcttgggaagggtagagttagtggagttttgaggtctcactaccctttgaggaaggcagcttttaattcagtctttttatctcatatgtgcagatcttgcaactgcttgatttacatggtagcaatgaattcagtgccacgttgatactaggagaagcagcaactaatagctattctgagtagaggctctcttcatatattcttggtcatattaaatgtcaaagtcagtccgttgggtcttctcactgctgctggagttaggtggttgagcctgggttttacttcagtgctgtcaaatctttgcagggcttgtgtggctttcaaagtcctttttatcactgtgatcatattctgggcggggaaatgttatcatcattgcttgagacgagatgttgaacatagtgataccaatccccagataaaaaggtcaaaataacctttagtgtttagccaagaagagattgtgactattgatctgaagcagctgggctctgttaatgtcttatttcaaacctagcatacatttgaagactatttggtcttaaaccaaagtaactgtaggacgaatgacatactacctagacattagtgtccgtttcatacgtcagaaacaccatgggaaaaagtacctagagattagtatctttaatacaaatctgagttttttctgtaattatcatgatttcatcaatgtaagtaagggtttgttgttacagttgtatcacctgcttaaataagctcttgtgctataatcaggtacttttggggcctttgttttcagttttttccatttctaacccttcgagatctgctttatagaaatccagggaccaatgtattttatcactaaaactgtttttatataattttaagaccataccaaaagttatctgagttaaagttgtaatacgtttcttactttcttgcaaggaaatgggtttttactgaagacacttctcatgatatctgaagttgaagaatcattatgtttttcttacctaagtggataaaatgtgctttgatgaatcagggaattttttaaagttcgaatttagttctaaattgagtttacatgtttacagctaattttttgtgtagggatagtttgattctctaggtggccaatactgaatataaaaataacttaaaaattgagataggtcatggttaatgtggctataactatatatacatctaattagagaaatatttctatgtaattttgtagtgcagtctgttgtttctattgccaatcaaagacttccccccagccccaaagtgtagtatggctaagacatatcttctgacaaattacatattatcttgtcaataccctggttaagctagcatgaaggaagtatgacttactgaggcttacacaacttgagtcccttatatcttcagctctgtttttcccactctgcctttctgctgccccctggctcagagacttagtgttcctgaccccacctccagcctttggacctaagagctgcttttgagacctaaaatgaagtgattgatggaagctgtgtgacatttttccacttccttgagtcactgggtgttatgagggagtgatctgcaaattggggtagggggtgcccctactggtagccctgctttgatgtcagctctgggcaaagattagggtgacagctaagtggcagtggaagttggcctcagaagtagtggccagctgtgtctctagtaggacagtaaaggcatgaagctcagcctgtaatcctgctactacagtagtactccagaagtgccttgaggccctgtgtggggctgtggccatcaagaattccagattttggttctcgctgcagacttaagtggccatgtagccatttttgtaatccatacatgtttgactcttccctctgcaaattgtcagatacgtaaaaccaatgacaaactactacttaacatgcacaccaaaatctgcccagaagacattgtgatttcattccatgcactgaaggaatgattgtaaatcatttctttgttccttggtcatgggagtgttctggttctacattgtggagattccagctgttgttctgttatagcccagcagaacaagtcgacgtgttgaaattctgaagaatagtttgggagtgcagtacagcttcatgtgttggatgttgaaactttcatgggccctctttagaaaagcagaggactgtcagcacattatttttaatcctgttatgcactcgtacttattgtcagtaacaataagtacgagtattgaaaatattgtcagtaacattcagtctctttcttaaagtgaatttgcttatttttcaatgagatttgtgagtttaatattatgaactgtgttttgataatccctttttcacattgtgccaatggaatggaatatttgatatttctttatatgtcaaggagatgcttcaatatgtcatttgctttaaacttaaattacctctcaagagaccaaggtacatttacctcattgtgtatataatgtttaatatttgtcagcatccaccaggtttgcaattttatttctataaagtgtgagtgttacgttgctaagttactcagatggtactgtattgtttatatctgtaccccaaatgacatcatctagactttgttttctgtgtcttattgtatttgtgcagtcctttaaccctgttggtgtgattgctgccctttcagatatgtgcaggtgtctatagaaattctcatttaaggtgaatggttttgagaaacctgtgaagagagaagcataaactgcatttccccatcagttttttaaatgtacattgtatgtgtagtaatattccagatgaattgtaaataaaagctagggagatgcttaaatttcatcctaacactacagtagaaaatggaagcaatgcaaataaacaactttttcccacca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]