ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-28 02:14:13, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_036155438 875 bp mRNA linear ROD 07-FEB-2024
DEFINITION PREDICTED: Mus musculus predicted pseudogene 5161 (Gm5161), mRNA.
ACCESSION XM_036155438
VERSION XM_036155438.1
DBLINK BioProject: PRJNA169
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000075.7) annotated using gene prediction method: Gnomon.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001635.27-RS_2024_02
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 02/01/2024
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..875
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6J"
/db_xref="taxon:10090"
/chromosome="9"
gene 1..875
/gene="Gm5161"
/note="predicted pseudogene 5161; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 6
Proteins, and 74% coverage of the annotated genomic
feature by RNAseq alignments"
/db_xref="GeneID:382099"
/db_xref="MGI:MGI:3648529"
CDS 1..846
/gene="Gm5161"
/codon_start=1
/product="U1 small nuclear ribonucleoprotein A-like"
/protein_id="XP_036011331.1"
/db_xref="GeneID:382099"
/db_xref="MGI:MGI:3648529"
/translation="
MAVPETRPNHTIYINSLNEKIKKDELKKSPYAIFSQFGQILDILVSQSLKMRGQSFVIFKEVSSTINALRSMQGFPFYGKPMHIQYAKTDSDIIAKMKGTFVERDRKREKRKPKSQEKPAVKKGCSGWGSAPVVGAVQPVPGMPPMPQAPRVMHHMPGQPPYMRPPGMILPPGLPPGQIPSRAMPPQQLIPGQMPHAQPLSENPPNHILFLTNLPEETNELMLSMLFTQFPGFKEVRLVPGRHDIDFVEFDNEVQAGAARDVLQGFKITQNNAMKISFAKK"
misc_feature 19..285
/gene="Gm5161"
/note="RNA recognition motif (RRM) superfamily; Region:
RRM_SF; cl17169"
/db_xref="CDD:473069"
misc_feature <34..>618
/gene="Gm5161"
/note="polyadenylate binding protein, human types 1, 2, 3,
4 family; Region: PABP-1234; TIGR01628"
/db_xref="CDD:130689"
misc_feature 589..843
/gene="Gm5161"
/note="RNA recognition motif (RRM) superfamily; Region:
RRM_SF; cl17169"
/db_xref="CDD:473069"
ORIGIN
atggcagttcccgagacccgtcccaaccacactatttatatcaacagtctcaacgagaagatcaagaaagatgagctcaagaagtccccgtatgccatcttctcccagtttggccagatcctggatatcctggtgtctcagagcctgaagatgaggggccagtccttcgtcatcttcaaggaggtcagcagcaccatcaacgccctgcgctccatgcagggcttccccttctacggcaagcccatgcatatccagtacgcaaagactgactcggacatcattgccaagatgaagggcacctttgtggagagagatcgcaaacgagagaagaggaagcccaagagtcaggagaaacctgctgtcaaaaaaggctgttcagggtggggcagtgcccccgtggtgggtgctgtccagcctgtaccgggcatgccaccgatgcctcaggcaccccgtgttatgcaccacatgccaggacagcctccctacatgcgaccacctggcatgatcctgccaccaggcctccctcctggccagatcccctctagggccatgcccccacagcagctcatacctgggcagatgccgcatgcgcagcctctctccgagaatccacccaatcacatcctgttcctcaccaacctgcctgaggagaccaacgagctcatgctctccatgcttttcacccagttccctggcttcaaggaggtgcgtctggtccctgggcgccatgacatcgacttcgtggagtttgacaatgaagtgcaggctggagcagcacgagatgtcctgcaaggctttaagatcacacagaacaatgctatgaagatctcttttgccaagaagtagcaccttcccctatggagtaccccagtccc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]