ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-09-28 02:14:34, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS XM_036152810 789 bp mRNA linear ROD 07-FEB-2024
DEFINITION PREDICTED: Mus musculus ribosomal protein S5 (Rps5), transcript
variant X1, mRNA.
ACCESSION XM_036152810
VERSION XM_036152810.1
DBLINK BioProject: PRJNA169
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT MODEL REFSEQ: This record is predicted by automated computational
analysis. This record is derived from a genomic sequence
(NC_000073.7) annotated using gene prediction method: Gnomon,
supported by mRNA and EST evidence.
Also see:
Documentation of NCBI's Annotation Process
##Genome-Annotation-Data-START##
Annotation Provider :: NCBI RefSeq
Annotation Status :: Updated annotation
Annotation Name :: GCF_000001635.27-RS_2024_02
Annotation Pipeline :: NCBI eukaryotic genome annotation
pipeline
Annotation Software Version :: 10.2
Annotation Method :: Best-placed RefSeq; Gnomon;
RefSeqFE; cmsearch; tRNAscan-SE
Features Annotated :: Gene; mRNA; CDS; ncRNA
Annotation Date :: 02/01/2024
##Genome-Annotation-Data-END##
FEATURES Location/Qualifiers
source 1..789
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6J"
/db_xref="taxon:10090"
/chromosome="7"
gene 1..789
/gene="Rps5"
/note="ribosomal protein S5; Derived by automated
computational analysis using gene prediction method:
Gnomon. Supporting evidence includes similarity to: 1
mRNA, 193 ESTs, 18211 long SRA reads, 500 Proteins, and
100% coverage of the annotated genomic feature by RNAseq
alignments, including 56 samples with support for all
annotated introns"
/db_xref="GeneID:20103"
/db_xref="MGI:MGI:1097682"
CDS 129..743
/gene="Rps5"
/codon_start=1
/product="small ribosomal subunit protein uS7 isoform X1"
/protein_id="XP_036008703.1"
/db_xref="GeneID:20103"
/db_xref="MGI:MGI:1097682"
/translation="
MTEWEAATPAVAETPDIKLFGKWSTDDVQINDISLQDYIAVKEKYAKYLPHSAGRYAAKRFRKAQCPIVERLTNSMMMHGRNNGKKLMTVRIVKHAFEIIHLLTGENPLQVLVNAIINSGPREDSTRIGRAGTVRRQAVDVSPLRRVNQAIWLLCTGAREAAFRNIKTIAECLADELINAAKGSSNSYAIKKKDELERVAKSNR"
misc_feature 180..740
/gene="Rps5"
/note="Eukaryota homolog of Ribosomal Protein S7; Region:
uS7_Eukaryote; cd14867"
/db_xref="CDD:271246"
misc_feature order(180..182,267..275,279..290,387..389,399..401)
/gene="Rps5"
/note="S9 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(279..281,285..287,297..308,315..317,339..341,
348..350,354..368,378..392,399..401,519..527,531..533,
561..563,582..584,603..605,612..614,630..635)
/gene="Rps5"
/note="rRNA binding site [nucleotide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(411..413,420..425,432..434,630..632,636..641)
/gene="Rps5"
/note="S25 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
misc_feature order(516..518,525..527,531..533,738..740)
/gene="Rps5"
/note="S11 interface [polypeptide binding]; other site"
/db_xref="CDD:271246"
ORIGIN
gcgctagtccgctgcgcgcggcctcttcctgtctgtatcagggcggcgcgtggtccacgccgagcgactgagaagcccagtctgcgccctcaggtgaggctgcggagggacacggagttcagaagaggatgactgagtgggaagcagccacaccagcggtggcagagacccctgacatcaagctctttgggaaatggagcactgatgacgtgcagatcaacgatatttctctgcaggattacattgctgtgaaggagaagtatgccaagtacctgccccacagtgccggacggtatgctgccaagcgcttccgcaaagcacaatgtcccatcgtggagcgccttactaactccatgatgatgcatggtcgtaacaacggcaagaagctcatgactgtgcgaattgtcaagcatgcctttgagatcatccacctgctcactggtgagaaccctctgcaggtcctggtgaatgctatcatcaacagtggcccccgagaagactcaacacgcattgggcgggccggtacagtgagacgacaggctgtggatgtgtccccactgcgtcgagtgaatcaggccatctggctgctgtgcacaggggctcgtgaggctgctttccggaacatcaagaccatcgccgagtgccttgcagatgagctcattaatgctgccaagggctcctccaattcctatgccatcaagaagaaagatgaactggagcgtgtggccaagtctaaccgctgatttcccagctgctgcctaataaactgtgtcctttggaacaactata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]