GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-09-28 02:16:08, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       XM_017312234            1288 bp    mRNA    linear   ROD 07-FEB-2024
DEFINITION  PREDICTED: Mus musculus tripartite motif-containing 5 (Trim5),
            transcript variant X3, mRNA.
ACCESSION   XM_017312234
VERSION     XM_017312234.3
DBLINK      BioProject: PRJNA169
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_000073.7) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Sep 21, 2020 this sequence version replaced XM_017312234.2.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_000001635.27-RS_2024_02
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.2
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           RefSeqFE; cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 02/01/2024
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1288
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6J"
                     /db_xref="taxon:10090"
                     /chromosome="7"
     gene            1..1288
                     /gene="Trim5"
                     /gene_synonym="EG667823; Gm8833"
                     /note="tripartite motif-containing 5; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 1 EST,
                     1 long SRA read, 10 Proteins, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     7 samples with support for all annotated introns"
                     /db_xref="GeneID:667823"
                     /db_xref="MGI:MGI:3646853"
     CDS             215..1006
                     /gene="Trim5"
                     /gene_synonym="EG667823; Gm8833"
                     /codon_start=1
                     /product="tripartite motif-containing 5 isoform X3"
                     /protein_id="XP_017167723.1"
                     /db_xref="GeneID:667823"
                     /db_xref="MGI:MGI:3646853"
                     /translation="
MASQFMKNLKEEVTCPVCLNLMVKPVSADCGHTFCQGCITLYFESIKCDKEMFSCPVCRLSYQSSNLRPNLHVANIVERLKEFKPSPEEEQKVFNCARHGEKLQLFCRKDMMAICWLCERSQEHRGHKTALIEEVAREYKEQLQVVLQRLMADKKEFENWKDELQKDRTYWENQIQKDVENVQSEFKRMRDIIDSEEKNELQKLRQEKEDILNNLAESESEHAQQSKLLEDFISDVEHQLQCSDIEILQGVENIIKRGQAPWF"
     misc_feature    236..448
                     /gene="Trim5"
                     /gene_synonym="EG667823; Gm8833"
                     /note="RING finger (Really Interesting New Gene) domain
                     and U-box domain superfamily; Region: RING_Ubox; cl17238"
                     /db_xref="CDD:473075"
     misc_feature    order(257..259,266..268,302..304,308..310,317..319,
                     326..328,377..379,386..388)
                     /gene="Trim5"
                     /gene_synonym="EG667823; Gm8833"
                     /note="cross-brace motif; other site"
                     /db_xref="CDD:438253"
     misc_feature    500..613
                     /gene="Trim5"
                     /gene_synonym="EG667823; Gm8833"
                     /note="B-box-type 2 zinc finger found in tripartite
                     motif-containing proteins, TRIM5, TRIM6, TRIM22, TRIM34,
                     TRIM38 and similar proteins; Region: Bbox2_TRIM5-like;
                     cd19761"
                     /db_xref="CDD:380819"
     misc_feature    <563..>931
                     /gene="Trim5"
                     /gene_synonym="EG667823; Gm8833"
                     /note="RecF/RecN/SMC N terminal domain; Region: SMC_N;
                     cl47134"
                     /db_xref="CDD:481474"
ORIGIN      
atgctgatatgagggtaacttcctcagtcagtggggttctgcaggcttatgcaaaggcatctcattggtctgtagagttgtggtttctgtttcatttccagagctcaaactttcctttctctagattttagccggaaataccttgaagttctggattggcacctgagcagaagtgcaaggagtccggacagtcatacacaggatcacagcaactatggcttcacaattcatgaagaatttaaaggaggaggtgacctgtcctgtctgtctgaacctgatggtgaaacctgtgagtgcagattgtggtcacaccttctgccaaggctgcatcacgttgtactttgaatccatcaaatgtgataaggaaatgttcagttgccctgtgtgccgacttagttaccagtctagcaatctgaggcctaatctacatgtggccaacatagtagagaggctcaaagagttcaagcccagcccagaagaggagcagaaagtgtttaactgtgcaagacatggagagaaactccagctcttctgtaggaaggacatgatggccatctgctggctttgtgagcgatctcaggagcaccggggccacaaaacagctctcattgaagaggtggcccgggagtacaaggagcagctgcaggtagttctgcaaaggctgatggcagataagaaagaatttgaaaactggaaagatgaacttcagaaggatagaacttactgggagaatcaaatacagaaagatgtggagaatgttcagtcagagtttaaacgaatgagggatatcatagactcagaggagaagaatgaattgcagaagctgaggcaagagaaggaagacattctcaacaacctggcagagtctgaaagtgagcatgctcagcagagcaagttgctagaagacttcatctcagatgtggaacatcagttacagtgctcagacatagaaatactacagggtgtggagaacatcataaaacgagggcaagcaccatggttctgagaatgtaagaccttcccaacacttcgttgaatgtaatttgaaggagacatgattgtattcatgtgactggcatctctctacctcttcagcttcctcgaaagagctcaaggtcatctgtggtggaaaggagaggaatctgtgggagttgggggtcactgggagggattgcaggtcaattgctttttatccctaggagtcttactttttcgatgaagaagcccaaaaccatcgccagggaacaaagaaagttccgagcccctgacctgcaaggcatgctgcaag
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]