LOCUS       NR_045520               1540 bp    RNA     linear   ROD 21-AUG-2022
DEFINITION  Mus musculus lipase maturation factor 1 (Lmf1), transcript variant
            2, non-coding RNA.
ACCESSION   NR_045520
VERSION     NR_045520.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1540)
  AUTHORS   Sha H, Sun S, Francisco AB, Ehrhardt N, Xue Z, Liu L, Lawrence P,
            Mattijssen F, Guber RD, Panhwar MS, Brenna JT, Shi H, Xue B,
            Kersten S, Bensadoun A, Peterfy M, Long Q and Qi L.
  TITLE     The ER-associated degradation adaptor protein Sel1L regulates LPL
            secretion and lipid metabolism
  JOURNAL   Cell Metab 20 (3), 458-470 (2014)
   PUBMED   25066055
REFERENCE   2  (bases 1 to 1540)
  AUTHORS   Mao HZ, Ehrhardt N, Bedoya C, Gomez JA, DeZwaan-McCabe D, Mungrue
            IN, Kaufman RJ, Rutkowski DT and Peterfy M.
  TITLE     Lipase maturation factor 1 (lmf1) is induced by endoplasmic
            reticulum stress through activating transcription factor 6alpha
            (Atf6alpha) signaling
  JOURNAL   J Biol Chem 289 (35), 24417-24427 (2014)
   PUBMED   25035425
  REMARK    GeneRIF: determined the alpha-synuclein-binding domain of beta-III
            tubulin and demonstrated that a short fragment containing this
            domain can suppress alpha-synuclein accumulation in the primary
            cultured cells
REFERENCE   3  (bases 1 to 1540)
  AUTHORS   Ehrhardt N, Bedoya C and Peterfy M.
  TITLE     Embryonic viability, lipase deficiency, hypertriglyceridemia and
            neonatal lethality in a novel LMF1-deficient mouse model
  JOURNAL   Nutr Metab (Lond) 11, 37 (2014)
   PUBMED   25302068
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 1540)
  AUTHORS   Hosseini M, Ehrhardt N, Weissglas-Volkov D, Lai CM, Mao HZ, Liao
            JL, Nikkola E, Bensadoun A, Taskinen MR, Doolittle MH, Pajukanta P
            and Peterfy M.
  TITLE     Transgenic expression and genetic variation of Lmf1 affect LPL
            activity in mice and humans
  JOURNAL   Arterioscler Thromb Vasc Biol 32 (5), 1204-1210 (2012)
   PUBMED   22345169
  REMARK    GeneRIF: variation in Lmf1 expression is a posttranslational
            determinant of LPL activity.
REFERENCE   5  (bases 1 to 1540)
  AUTHORS   Yin F, Doolittle MH and Peterfy M.
  TITLE     A quantitative assay measuring the function of lipase maturation
            factor 1
  JOURNAL   J Lipid Res 50 (11), 2265-2269 (2009)
   PUBMED   19471043
  REMARK    GeneRIF: Results show that cotransfection of LPL with wild-type
            Lmf1 restores its ability to support normal lipase maturation.
REFERENCE   6  (bases 1 to 1540)
  AUTHORS   Ebersole T, Lai F and Artzt K.
  TITLE     New molecular markers for the distal end of the t-complex and their
            relationships to mutations affecting mouse development
  JOURNAL   Genetics 131 (1), 175-182 (1992)
   PUBMED   1350556
REFERENCE   7  (bases 1 to 1540)
  AUTHORS   Lai F and Artzt K.
  TITLE     Map positions of four dinucleotide repeats in the mouse t complex
  JOURNAL   Mamm Genome 3 (8), 476-477 (1992)
   PUBMED   1643311
REFERENCE   8  (bases 1 to 1540)
  AUTHORS   Oka K, Nakano T, Tkalcevic GT, Scow RO and Brown WV.
  TITLE     Molecular cloning of mouse hepatic triacylglycerol lipase: gene
            expression in combined lipase-deficient (cld/cld) mice
  JOURNAL   Biochim Biophys Acta 1089 (1), 13-20 (1991)
   PUBMED   2025643
REFERENCE   9  (bases 1 to 1540)
  AUTHORS   Davis RC, Ben-Zeev O, Martin D and Doolittle MH.
  TITLE     Combined lipase deficiency in the mouse. Evidence of impaired
            lipase processing and secretion
  JOURNAL   J Biol Chem 265 (29), 17960-17966 (1990)
   PUBMED   2211673
REFERENCE   10 (bases 1 to 1540)
  AUTHORS   Oka K, Yuan JG, Senda M, Masibay AS, Qasba PK, Masuno H, Scow RO,
            Paterniti JR Jr and Brown WV.
  TITLE     Expression of lipoprotein lipase gene in combined lipase deficiency
  JOURNAL   Biochim Biophys Acta 1008 (3), 351-354 (1989)
   PUBMED   2474325
  REMARK    Erratum:[Biochim Biophys Acta 1989 Nov 2;1009(2):199. Oasba PK
            [corrected to Qasba PK]]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC154418.2 and AC134908.5.
            
            Transcript Variant: This variant (2) lacks two consecutive internal
            exons compared to variant 1. This variant is represented as
            non-coding because the use of the 5'-most expected translational
            start codon renders the transcript a candidate for
            nonsense-mediated mRNA decay (NMD).
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK041659.1, SRR7345562.2106856.1
                                           [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849379
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-206               AC154418.2         132101-132306
            207-355             AC154418.2         165223-165371
            356-421             AC154418.2         184662-184727
            422-589             AC134908.5         19084-19251
            590-776             AC134908.5         28355-28541
            777-930             AC134908.5         29023-29176
            931-1114            AC134908.5         29320-29503
            1115-1227           AC134908.5         29936-30048
            1228-1540           AC134908.5         36449-36761
FEATURES             Location/Qualifiers
     source          1..1540
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="17"
                     /map="17 12.7 cM"
     gene            1..1540
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /note="lipase maturation factor 1"
                     /db_xref="GeneID:76483"
                     /db_xref="MGI:MGI:1923733"
     misc_RNA        1..1540
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /product="lipase maturation factor 1, transcript variant
                     2"
                     /db_xref="GeneID:76483"
                     /db_xref="MGI:MGI:1923733"
     exon            1..206
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     misc_feature    14..208
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_029624.4"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated decay (NMD)
                     candidate"
     exon            207..355
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            356..421
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            422..589
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            590..776
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            777..930
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            931..1114
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            1115..1227
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
     exon            1228..1540
                     /gene="Lmf1"
                     /gene_synonym="2400010G15Rik; cld; Tmem112"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gccctttgtgctcatgcgcccagacagcctagtaatggctgcgcccgaggggtcgctgagaaaacggaaggtcgggggtgcggagcacagtccagcgtcgcaaccttctctggctagagatcccgcagattctccagctcggctgcacacgggcaccttctggctgactagaatcgtgctcctgcgggccctcgctttcatttactgatgggagtcacagctgctggaaacaggattcctggggatctttctgagccctctctggacactgtcccgcctgcccaagaacacccccacatcccagattgtcctgtggggcttccgctggctgatcttcagaatcatgcttggagcgggcctcatcaaggtccgcggggacaagtgctggctggatctgacctgcatggacttccactatgagactcagcccgtgcccaacccgatagcctactacctgcacaggtcaccatggtggttccaccgctttgagaccctcagcaaccacttcgtggagcttcttgtgcctttcttcctgttccttggacggcggatgcgcattcttcatggagtgctgcagatccttttccaggtgatcctcatcatcagtgggaacctgagcttcctgaactggctcaccatcgtgcccagccttgcctgcttcgacgatgcagctctgggattcctgtttccctcaggacctcaaggcctaaagaagcaagtcctggagattcagagggaagatacacaaagggtccagcccaagccaagagacagaggctgcttggtgcggcaagtggtcaacatctccctgggcatcctggtggcctggctcagcgtacccgtggttatcaatctgctaagctccaggcagatcatgaacacctccttcaacccgctcaggatcgtcaacacctatggggcctttggaagtgtcaccaaagagcggactgaggtgatcctgcagggcacagtgagccccaacgccagcgcacctgatgcagtgtgggaagactatgagttcaagtgcaaaccgggcgacccctggaggcagccatgcctcatctcgccataccactaccgcctggactggctgatgtggttcgcagctttccagacctatgagcagaacgagtggatccttcatctggcgggtaagctcctagctggtgactctgaagccctggccctacttgctgttaacccctttgagggcaggactccccccaggtggatccgaggagaacactaccggtacaagttcagcctccccgggggccagcacgccacccagggcaagtggtggatccgcaagcgaattggtccttacttccccccactccgccttgaggatctgaaggaatactttaagactcgggagtggccactaccagaacccccatctagacacacacgctgaaataaagaccagagaccaaccgcttctctacctatactgtgctgcggccacgggacccgcacagggacccggcagcccatggatcctgccaagaagagattggaaaaggatgtgcttcctagc

//