ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 09:58:22, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NR_039549 100 bp RNA linear ROD 23-SEP-2025
DEFINITION Mus musculus microRNA 3968 (Mir3968), microRNA.
ACCESSION NR_039549
VERSION NR_039549.1
KEYWORDS RefSeq.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 100)
AUTHORS Polikepahad,S. and Corry,D.B.
TITLE Profiling of T helper cell-derived small RNAs reveals unique
antisense transcripts and differential association of miRNAs with
argonaute proteins 1 and 2
JOURNAL Nucleic Acids Res 41 (2), 1164-1177 (2013)
PUBMED 23185045
REFERENCE 2 (bases 1 to 100)
AUTHORS Kutter,C., Watt,S., Stefflova,K., Wilson,M.D., Goncalves,A.,
Ponting,C.P., Odom,D.T. and Marques,A.C.
TITLE Rapid turnover of long noncoding RNAs and the evolution of gene
expression
JOURNAL PLoS Genet 8 (7), e1002841 (2012)
PUBMED 22844254
REFERENCE 3 (bases 1 to 100)
AUTHORS Fehniger,T.A., Wylie,T., Germino,E., Leong,J.W., Magrini,V.J.,
Koul,S., Keppel,C.R., Schneider,S.E., Koboldt,D.C., Sullivan,R.P.,
Heinz,M.E., Crosby,S.D., Nagarajan,R., Ramsingh,G., Link,D.C.,
Ley,T.J. and Mardis,E.R.
TITLE Next-generation sequencing identifies the natural killer cell
microRNA transcriptome
JOURNAL Genome Res 20 (11), 1590-1604 (2010)
PUBMED 20935160
REFERENCE 4 (bases 1 to 100)
AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
Enright,A.J.
TITLE miRBase: microRNA sequences, targets and gene nomenclature
JOURNAL Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
PUBMED 16381832
COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation
provided by NCBI staff in collaboration with miRBase. The reference
sequence was derived from AL645470.20.
Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
that are involved in post-transcriptional regulation of gene
expression in multicellular organisms by affecting both the
stability and translation of mRNAs. miRNAs are transcribed by RNA
polymerase II as part of capped and polyadenylated primary
transcripts (pri-miRNAs) that can be either protein-coding or
non-coding. The primary transcript is cleaved by the Drosha
ribonuclease III enzyme to produce an approximately 70-nt stem-loop
precursor miRNA (pre-miRNA), which is further cleaved by the
cytoplasmic Dicer ribonuclease to generate the mature miRNA and
antisense miRNA star (miRNA*) products. The mature miRNA is
incorporated into a RNA-induced silencing complex (RISC), which
recognizes target mRNAs through imperfect base pairing with the
miRNA and most commonly results in translational inhibition or
destabilization of the target mRNA. The RefSeq represents the
predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
Sequence Note: This record represents a predicted microRNA
stem-loop as defined by miRBase. Some sequence at the 5' and 3'
ends may not be included in the intermediate precursor miRNA
produced by Drosha cleavage.
##Evidence-Data-START##
Transcript is intronless :: AI449766.1, CR518727.1 [ECO:0000345]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-100 AL645470.20 176764-176863
FEATURES Location/Qualifiers
source 1..100
/organism="Mus musculus"
/mol_type="transcribed RNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="11"
/map="11 80.84 cM"
gene 1..100
/gene="Mir3968"
/gene_synonym="mmu-mir-3968; mu-mir-3968"
/note="microRNA 3968"
/db_xref="GeneID:100628623"
/db_xref="MGI:MGI:4950407"
/db_xref="miRBase:MI0016977"
precursor_RNA 1..100
/gene="Mir3968"
/gene_synonym="mmu-mir-3968; mu-mir-3968"
/product="microRNA 3968"
/db_xref="GeneID:100628623"
/db_xref="MGI:MGI:4950407"
/db_xref="miRBase:MI0016977"
exon 1..100
/gene="Mir3968"
/gene_synonym="mmu-mir-3968; mu-mir-3968"
/inference="alignment:Splign:2.1.0"
ncRNA 72..92
/ncRNA_class="miRNA"
/gene="Mir3968"
/gene_synonym="mmu-mir-3968; mu-mir-3968"
/product="mmu-miR-3968"
/db_xref="miRBase:MIMAT0019352"
/db_xref="GeneID:100628623"
/db_xref="MGI:MGI:4950407"
/db_xref="miRBase:MI0016977"
ORIGIN
acgccgagcgtgtggtggtaggatccgtgtagcaccgtctgtgtgttgttgtgccacacagagaacttgagcgaatcccactccagacaccatgagtagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]