GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2026-06-21 09:58:22, GGRNA.v2 : RefSeq release 233 (Jan, 2026)

LOCUS       NR_039549                100 bp    RNA     linear   ROD 23-SEP-2025
DEFINITION  Mus musculus microRNA 3968 (Mir3968), microRNA.
ACCESSION   NR_039549
VERSION     NR_039549.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 100)
  AUTHORS   Polikepahad,S. and Corry,D.B.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   2  (bases 1 to 100)
  AUTHORS   Kutter,C., Watt,S., Stefflova,K., Wilson,M.D., Goncalves,A.,
            Ponting,C.P., Odom,D.T. and Marques,A.C.
  TITLE     Rapid turnover of long noncoding RNAs and the evolution of gene
            expression
  JOURNAL   PLoS Genet 8 (7), e1002841 (2012)
   PUBMED   22844254
REFERENCE   3  (bases 1 to 100)
  AUTHORS   Fehniger,T.A., Wylie,T., Germino,E., Leong,J.W., Magrini,V.J.,
            Koul,S., Keppel,C.R., Schneider,S.E., Koboldt,D.C., Sullivan,R.P.,
            Heinz,M.E., Crosby,S.D., Nagarajan,R., Ramsingh,G., Link,D.C.,
            Ley,T.J. and Mardis,E.R.
  TITLE     Next-generation sequencing identifies the natural killer cell
            microRNA transcriptome
  JOURNAL   Genome Res 20 (11), 1590-1604 (2010)
   PUBMED   20935160
REFERENCE   4  (bases 1 to 100)
  AUTHORS   Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and
            Enright,A.J.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL645470.20.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: AI449766.1, CR518727.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-100               AL645470.20        176764-176863
FEATURES             Location/Qualifiers
     source          1..100
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="11"
                     /map="11 80.84 cM"
     gene            1..100
                     /gene="Mir3968"
                     /gene_synonym="mmu-mir-3968; mu-mir-3968"
                     /note="microRNA 3968"
                     /db_xref="GeneID:100628623"
                     /db_xref="MGI:MGI:4950407"
                     /db_xref="miRBase:MI0016977"
     precursor_RNA   1..100
                     /gene="Mir3968"
                     /gene_synonym="mmu-mir-3968; mu-mir-3968"
                     /product="microRNA 3968"
                     /db_xref="GeneID:100628623"
                     /db_xref="MGI:MGI:4950407"
                     /db_xref="miRBase:MI0016977"
     exon            1..100
                     /gene="Mir3968"
                     /gene_synonym="mmu-mir-3968; mu-mir-3968"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           72..92
                     /ncRNA_class="miRNA"
                     /gene="Mir3968"
                     /gene_synonym="mmu-mir-3968; mu-mir-3968"
                     /product="mmu-miR-3968"
                     /db_xref="miRBase:MIMAT0019352"
                     /db_xref="GeneID:100628623"
                     /db_xref="MGI:MGI:4950407"
                     /db_xref="miRBase:MI0016977"
ORIGIN      
acgccgagcgtgtggtggtaggatccgtgtagcaccgtctgtgtgttgttgtgccacacagagaacttgagcgaatcccactccagacaccatgagtagg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]