LOCUS       NR_037298                 49 bp    RNA     linear   ROD 10-AUG-2021
DEFINITION  Mus musculus microRNA 374c (Mir374c), microRNA.
ACCESSION   NR_037298
VERSION     NR_037298.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 49)
  AUTHORS   Dong LI, Zheng Y, Gao L and Luo X.
  TITLE     lncRNA NEAT1 prompts autophagy and apoptosis in MPTP-induced
            Parkinson's disease by impairing miR-374c-5p
  JOURNAL   Acta Biochim Biophys Sin (Shanghai) 53 (7), 870-882 (2021)
   PUBMED   33984130
  REMARK    GeneRIF: lncRNA NEAT1 prompts autophagy and apoptosis in
            MPTP-induced Parkinson's disease by impairing miR-374c-5p.
REFERENCE   2  (bases 1 to 49)
  AUTHORS   Guan D, Li Y, Cui Y, Guo Y, Dong N, Li G, Dai Y and Ji L.
  TITLE     Down-regulated miR-374c and Hsp70 promote Th17 cell differentiation
            by inducing Fas expression in experimental autoimmune
            encephalomyelitis
  JOURNAL   Int J Biol Macromol 154, 1158-1165 (2020)
   PUBMED   31756487
  REMARK    GeneRIF: Down-regulated miR-374c and Hsp70 promote Th17 cell
            differentiation by inducing Fas expression in experimental
            autoimmune encephalomyelitis.
            Erratum:[Int J Biol Macromol. 2021 Jan 1;166:1617-1618. PMID:
            32800354]
REFERENCE   3  (bases 1 to 49)
  AUTHORS   Yang L, Liang H, Shen L, Guan Z and Meng X.
  TITLE     LncRNA Tug1 involves in the pulmonary vascular remodeling in mice
            with hypoxic pulmonary hypertension via the microRNA-374c-mediated
            Foxc1
  JOURNAL   Life Sci 237, 116769 (2019)
   PUBMED   31422096
  REMARK    GeneRIF: Low miR374c expression is associated with pulmonary
            hypertension.
REFERENCE   4  (bases 1 to 49)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   5  (bases 1 to 49)
  AUTHORS   Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D,
            Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP,
            Nusbaum C and Bartel DP.
  TITLE     Mammalian microRNAs: experimental evaluation of novel and
            previously annotated genes
  JOURNAL   Genes Dev 24 (10), 992-1009 (2010)
   PUBMED   20413612
REFERENCE   6  (bases 1 to 49)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL683845.15.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            ##Evidence-Data-START##
            Transcript is intronless :: SRR1660825.107189.1,
                                        SRR1660817.301912.1 [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-49                AL683845.15        39511-39559
FEATURES             Location/Qualifiers
     source          1..49
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 46.22 cM"
     gene            1..49
                     /gene="Mir374c"
                     /gene_synonym="mmu-mir-374c"
                     /note="microRNA 374c"
                     /db_xref="GeneID:100526513"
                     /db_xref="MGI:MGI:4834330"
                     /db_xref="miRBase:MI0014108"
     precursor_RNA   1..49
                     /gene="Mir374c"
                     /gene_synonym="mmu-mir-374c"
                     /product="microRNA 374c"
                     /db_xref="GeneID:100526513"
                     /db_xref="MGI:MGI:4834330"
                     /db_xref="miRBase:MI0014108"
     exon            1..49
                     /gene="Mir374c"
                     /gene_synonym="mmu-mir-374c"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           2..21
                     /ncRNA_class="miRNA"
                     /gene="Mir374c"
                     /gene_synonym="mmu-mir-374c"
                     /product="mmu-miR-374c-5p"
                     /db_xref="miRBase:MIMAT0014953"
                     /db_xref="GeneID:100526513"
                     /db_xref="MGI:MGI:4834330"
                     /db_xref="miRBase:MI0014108"
     ncRNA           29..47
                     /ncRNA_class="miRNA"
                     /gene="Mir374c"
                     /gene_synonym="mmu-mir-374c"
                     /product="mmu-miR-374c-3p"
                     /db_xref="miRBase:MIMAT0014954"
                     /db_xref="GeneID:100526513"
                     /db_xref="MGI:MGI:4834330"
                     /db_xref="miRBase:MI0014108"
ORIGIN      

gataatacaacctgctaagtgctagaacacttagcaggttgtattatat

//