LOCUS       NR_037254                 83 bp    RNA     linear   ROD 05-AUG-2023
DEFINITION  Mus musculus microRNA 467a-4 (Mir467a-4), microRNA.
ACCESSION   NR_037254
VERSION     NR_037254.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 83)
  AUTHORS   Gu QH, Yu D, Hu Z, Liu X, Yang Y, Luo Y, Zhu J and Li Z.
  TITLE     miR-26a and miR-384-5p are required for LTP maintenance and spine
            enlargement
  JOURNAL   Nat Commun 6, 6789 (2015)
   PUBMED   25858512
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 83)
  AUTHORS   Zhang Q, Liu H, McGee J, Walsh EJ, Soukup GA and He DZ.
  TITLE     Identifying microRNAs involved in degeneration of the organ of
            corti during age-related hearing loss
  JOURNAL   PLoS One 8 (4), e62786 (2013)
   PUBMED   23646144
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 83)
  AUTHORS   Polikepahad S and Corry DB.
  TITLE     Profiling of T helper cell-derived small RNAs reveals unique
            antisense transcripts and differential association of miRNAs with
            argonaute proteins 1 and 2
  JOURNAL   Nucleic Acids Res 41 (2), 1164-1177 (2013)
   PUBMED   23185045
REFERENCE   4  (bases 1 to 83)
  AUTHORS   Zheng GX, Ravi A, Gould GM, Burge CB and Sharp PA.
  TITLE     Genome-wide impact of a recently expanded microRNA cluster in mouse
  JOURNAL   Proc Natl Acad Sci U S A 108 (38), 15804-15809 (2011)
   PUBMED   21911408
REFERENCE   5  (bases 1 to 83)
  AUTHORS   Tarantino C, Paolella G, Cozzuto L, Minopoli G, Pastore L, Parisi S
            and Russo T.
  TITLE     miRNA 34a, 100, and 137 modulate differentiation of mouse embryonic
            stem cells
  JOURNAL   FASEB J 24 (9), 3255-3263 (2010)
   PUBMED   20439489
REFERENCE   6  (bases 1 to 83)
  AUTHORS   Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D,
            Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP,
            Nusbaum C and Bartel DP.
  TITLE     Mammalian microRNAs: experimental evaluation of novel and
            previously annotated genes
  JOURNAL   Genes Dev 24 (10), 992-1009 (2010)
   PUBMED   20413612
REFERENCE   7  (bases 1 to 83)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AL772216.15.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-83                AL772216.15        62169-62251
FEATURES             Location/Qualifiers
     source          1..83
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 8.22 cM"
     gene            1..83
                     /gene="Mir467a-4"
                     /gene_synonym="Mirn467a-4; mmu-mir-467a-4"
                     /note="microRNA 467a-4"
                     /db_xref="GeneID:100124625"
                     /db_xref="MGI:MGI:3719573"
                     /db_xref="miRBase:MI0014059"
     precursor_RNA   1..83
                     /gene="Mir467a-4"
                     /gene_synonym="Mirn467a-4; mmu-mir-467a-4"
                     /product="microRNA 467a-4"
                     /db_xref="GeneID:100124625"
                     /db_xref="MGI:MGI:3719573"
                     /db_xref="miRBase:MI0014059"
     exon            1..83
                     /gene="Mir467a-4"
                     /gene_synonym="Mirn467a-4; mmu-mir-467a-4"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           15..36
                     /ncRNA_class="miRNA"
                     /gene="Mir467a-4"
                     /gene_synonym="Mirn467a-4; mmu-mir-467a-4"
                     /product="mmu-miR-467a-5p"
                     /db_xref="miRBase:MIMAT0003409"
                     /db_xref="GeneID:100124625"
                     /db_xref="MGI:MGI:3719573"
                     /db_xref="miRBase:MI0014059"
     ncRNA           50..71
                     /ncRNA_class="miRNA"
                     /gene="Mir467a-4"
                     /gene_synonym="Mirn467a-4; mmu-mir-467a-4"
                     /product="mmu-miR-467a-3p"
                     /db_xref="miRBase:MIMAT0002108"
                     /db_xref="GeneID:100124625"
                     /db_xref="MGI:MGI:3719573"
                     /db_xref="miRBase:MI0014059"
ORIGIN      

tgtgcctgtgtgcgtaagtgcctgcatgtatatgcgtgtatattttatgcatatacatacacacacctacacacacatgcaca

//