LOCUS       NR_030490                 88 bp    RNA     linear   ROD 06-AUG-2023
DEFINITION  Mus musculus microRNA 709 (Mir709), microRNA.
ACCESSION   NR_030490
VERSION     NR_030490.1
KEYWORDS    RefSeq.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 88)
  AUTHORS   Chen JX, Wang YP, Zhang X, Li GX, Zheng K and Duan CZ.
  TITLE     lncRNA Mtss1 promotes inflammatory responses and secondary brain
            injury after intracerebral hemorrhage by targeting miR-709 in mice
  JOURNAL   Brain Res Bull 162, 20-29 (2020)
   PUBMED   32442560
  REMARK    GeneRIF: lncRNA Mtss1 promotes inflammatory responses and secondary
            brain injury after intracerebral hemorrhage by targeting miR-709 in
            mice.
REFERENCE   2  (bases 1 to 88)
  AUTHORS   Guo Y, Ni J, Chen S, Bai M, Lin J, Ding G, Zhang Y, Sun P, Jia Z,
            Huang S, Yang L and Zhang A.
  TITLE     MicroRNA-709 Mediates Acute Tubular Injury through Effects on
            Mitochondrial Function
  JOURNAL   J Am Soc Nephrol 29 (2), 449-461 (2018)
   PUBMED   29042455
  REMARK    GeneRIF: Collectively, our results suggest that miR-709 has an
            important role in mediating cisplatin-induced AKI via negative
            regulation of TFAM and subsequent mitochondrial dysfunction.
REFERENCE   3  (bases 1 to 88)
  AUTHORS   Li M, Chen H, Chen L, Chen Y, Liu X and Mo D.
  TITLE     miR-709 modulates LPS-induced inflammatory response through
            targeting GSK-3beta
  JOURNAL   Int Immunopharmacol 36, 333-338 (2016)
   PUBMED   27232654
  REMARK    GeneRIF: this paper shows that miR-709 attenuates LPS-induced
            inflammatory response via inhibiting GSK-3beta and activating
            beta-catenin
REFERENCE   4  (bases 1 to 88)
  AUTHORS   Surendran S, Jideonwo VN, Merchun C, Ahn M, Murray J, Ryan J, Dunn
            KW, Kota J and Morral N.
  TITLE     Gene targets of mouse miR-709: regulation of distinct pools
  JOURNAL   Sci Rep 6, 18958 (2016)
   PUBMED   26743462
  REMARK    GeneRIF: None of the previously identified targets in non-hepatic
            tissues are silenced by miR-709 in hepatocytes, even though several
            of these genes are abundantly expressed in liver.
            Publication Status: Online-Only
REFERENCE   5  (bases 1 to 88)
  AUTHORS   Liu T, Zhang X, Sha K, Liu X, Zhang L and Wang B.
  TITLE     miR-709 up-regulated in hepatocellular carcinoma, promotes
            proliferation and invasion by targeting GPC5
  JOURNAL   Cell Prolif 48 (3), 330-337 (2015)
   PUBMED   25818666
  REMARK    GeneRIF: miR-709 may positively regulate invasion and metastasis of
            hepatocellular carcinoma through targeting GPC5.
REFERENCE   6  (bases 1 to 88)
  AUTHORS   Aoi W, Naito Y, Mizushima K, Takanami Y, Kawai Y, Ichikawa H and
            Yoshikawa T.
  TITLE     The microRNA miR-696 regulates PGC-1{alpha} in mouse skeletal
            muscle in response to physical activity
  JOURNAL   Am J Physiol Endocrinol Metab 298 (4), E799-E806 (2010)
   PUBMED   20086200
REFERENCE   7  (bases 1 to 88)
  AUTHORS   Liu B, Cunha GR and Baskin LS.
  TITLE     Differential expression of microRNAs in mouse embryonic bladder
  JOURNAL   Biochem Biophys Res Commun 385 (4), 528-533 (2009)
   PUBMED   19470377
REFERENCE   8  (bases 1 to 88)
  AUTHORS   Tamminga J, Kathiria P, Koturbash I and Kovalchuk O.
  TITLE     DNA damage-induced upregulation of miR-709 in the germline
            downregulates BORIS to counteract aberrant DNA hypomethylation
  JOURNAL   Cell Cycle 7 (23), 3731-3736 (2008)
   PUBMED   19029807
  REMARK    GeneRIF: DNA damage-induced and ATR/Rfx1-mediated increase of
            miR-709 expression in exposed testes may be a protective mechanism
            that effectively decreases a cellular level of BORIS to prevent
            massive aberrant erasure of DNA methylation after radiation
            exposure.
REFERENCE   9  (bases 1 to 88)
  AUTHORS   Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M,
            Asada K, Mirochnitchenko O, Inouye M and Kato I.
  TITLE     The expression profile of microRNAs in mouse embryos
  JOURNAL   Nucleic Acids Res 34 (6), 1765-1771 (2006)
   PUBMED   16582102
  REMARK    Publication Status: Online-Only
REFERENCE   10 (bases 1 to 88)
  AUTHORS   Griffiths-Jones S, Grocock RJ, van Dongen S, Bateman A and Enright
            AJ.
  TITLE     miRBase: microRNA sequences, targets and gene nomenclature
  JOURNAL   Nucleic Acids Res 34 (Database issue), D140-D144 (2006)
   PUBMED   16381832
COMMENT     PROVISIONAL REFSEQ: This record is based on preliminary annotation
            provided by NCBI staff in collaboration with miRBase. The reference
            sequence was derived from AC159266.3.
            
            Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs
            that are involved in post-transcriptional regulation of gene
            expression in multicellular organisms by affecting both the
            stability and translation of mRNAs. miRNAs are transcribed by RNA
            polymerase II as part of capped and polyadenylated primary
            transcripts (pri-miRNAs) that can be either protein-coding or
            non-coding. The primary transcript is cleaved by the Drosha
            ribonuclease III enzyme to produce an approximately 70-nt stem-loop
            precursor miRNA (pre-miRNA), which is further cleaved by the
            cytoplasmic Dicer ribonuclease to generate the mature miRNA and
            antisense miRNA star (miRNA*) products. The mature miRNA is
            incorporated into a RNA-induced silencing complex (RISC), which
            recognizes target mRNAs through imperfect base pairing with the
            miRNA and most commonly results in translational inhibition or
            destabilization of the target mRNA. The RefSeq represents the
            predicted microRNA stem-loop. [provided by RefSeq, Sep 2009].
            
            Sequence Note: This record represents a predicted microRNA
            stem-loop as defined by miRBase. Some sequence at the 5' and 3'
            ends may not be included in the intermediate precursor miRNA
            produced by Drosha cleavage.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript is intronless :: LM609706.1, SRR7345562.3952953.1
                                        [ECO:0000345]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-88                AC159266.3         78348-78435
FEATURES             Location/Qualifiers
     source          1..88
                     /organism="Mus musculus"
                     /mol_type="transcribed RNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="8"
                     /map="8 40.29 cM"
     gene            1..88
                     /gene="Mir709"
                     /gene_synonym="mir-709; Mirn709; mmu-mir-709"
                     /note="microRNA 709"
                     /db_xref="GeneID:735271"
                     /db_xref="MGI:MGI:3629717"
                     /db_xref="miRBase:MI0004693"
     precursor_RNA   1..88
                     /gene="Mir709"
                     /gene_synonym="mir-709; Mirn709; mmu-mir-709"
                     /product="microRNA 709"
                     /db_xref="GeneID:735271"
                     /db_xref="MGI:MGI:3629717"
                     /db_xref="miRBase:MI0004693"
     exon            1..88
                     /gene="Mir709"
                     /gene_synonym="mir-709; Mirn709; mmu-mir-709"
                     /inference="alignment:Splign:2.1.0"
     ncRNA           69..87
                     /ncRNA_class="miRNA"
                     /gene="Mir709"
                     /gene_synonym="mir-709; Mirn709; mmu-mir-709"
                     /product="mmu-miR-709"
                     /db_xref="miRBase:MIMAT0003499"
                     /db_xref="GeneID:735271"
                     /db_xref="MGI:MGI:3629717"
                     /db_xref="miRBase:MI0004693"
ORIGIN      

tgtcccgtttctctgcttctactcagaagtgctctgagcatagaactgtcctgtttgagcagcactggggaggcagaggcaggaggat

//