2024-05-04 07:04:52, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_029384 743 bp RNA linear ROD 04-AUG-2023 DEFINITION Mus musculus orthodenticle homeobox 2 opposite strand 1 (Otx2os1), long non-coding RNA. ACCESSION NR_029384 VERSION NR_029384.1 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 743) AUTHORS Harrow JL, Steward CA, Frankish A, Gilbert JG, Gonzalez JM, Loveland JE, Mudge J, Sheppard D, Thomas M, Trevanion S and Wilming LG. TITLE The Vertebrate Genome Annotation browser 10 years on JOURNAL Nucleic Acids Res 42 (Database issue), D771-D779 (2014) PUBMED 24316575 REFERENCE 2 (bases 1 to 743) AUTHORS Alfano G, Vitiello C, Caccioppoli C, Caramico T, Carola A, Szego MJ, McInnes RR, Auricchio A and Banfi S. TITLE Natural antisense transcripts associated with genes involved in eye development JOURNAL Hum Mol Genet 14 (7), 913-923 (2005) PUBMED 15703187 COMMENT PREDICTED REFSEQ: This record has not been reviewed and the function is unknown. The reference sequence was derived from AK042665.1. ##Evidence-Data-START## Transcript exon combination :: AK042665.1 [ECO:0000332] RNAseq introns :: partial sample support SAMN01164138, SAMN01164141 [ECO:0000350] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-743 AK042665.1 1-743 FEATURES Location/Qualifiers source 1..743 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="14" /map="14 25.36 cM" gene 1..743 /gene="Otx2os1" /note="orthodenticle homeobox 2 opposite strand 1" /db_xref="GeneID:606497" /db_xref="MGI:MGI:3583292" ncRNA 1..743 /ncRNA_class="lncRNA" /gene="Otx2os1" /product="orthodenticle homeobox 2 opposite strand 1" /db_xref="GeneID:606497" /db_xref="MGI:MGI:3583292" exon 1..109 /gene="Otx2os1" /inference="alignment:Splign:2.1.0" exon 110..265 /gene="Otx2os1" /inference="alignment:Splign:2.1.0" exon 266..362 /gene="Otx2os1" /inference="alignment:Splign:2.1.0" exon 363..526 /gene="Otx2os1" /inference="alignment:Splign:2.1.0" exon 527..743 /gene="Otx2os1" /inference="alignment:Splign:2.1.0" ORIGIN
agttgtcccgcgtggcccgggctgtgggaagcaggtcctggctcttggtccgagccatcgtgctttgtatgatggaaaggcaaatccacgcgaatctcttgaaaaagagaggaattctgcccagactctccagcagttggtagcaggcaagctttctcctgtgtcgcctggaaaagttgcaaaattgctcttcacctgtaagaacatgcattttatcttccagtctcttcttgtcaatttggaaattgcagacaccccggctcaggagaaatggctctgtgcattggttttcctggctgaccctgagaataagcaactctgtccgcttgttgtctgaagttgtttgaagatgattagaggagaaataacaccaaagccctgagcaatgctttgcagacgtctaggggctcaggatgtgtgatgtagcccagttctatttgttgacatccagcttttgaaagcatcagcctttgagagtggaacaatattggagctatggagtcacctttacctggaaatatcgaagggtcatgaacttgtcgtcgtcgtcatcatcattgtcatcgtcatcatcatcaccatcaccaccagcagcagcagcagcagcagcagcagcagcaagattttgtgttgggaaggtacttccaaatgctacaggggacagaaggtcatcagctattggcccagggattatagcatggaagagttcctcttctcagaggatattaaactttttgaggatt
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]