2025-09-13 15:49:20, GGRNA.v2 : RefSeq release 231 (Jul, 2025)
LOCUS NR_027857 1912 bp RNA linear ROD 29-OCT-2024 DEFINITION Mus musculus NK6 homeobox 2 (Nkx6-2), transcript variant 2, non-coding RNA. ACCESSION NR_027857 VERSION NR_027857.2 KEYWORDS RefSeq. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1912) AUTHORS Ohyama,K., Shinohara,H.M., Takayama,N., Ogawa,R., Omura,S., Hayashida,M. and Takahashi,T. TITLE Differentiation stage-specific expression of transcriptional regulators for epithelial mesenchymal transition in dentate granule progenitors JOURNAL Front Neurosci 18, 1425849 (2024) PUBMED 39268037 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1912) AUTHORS Zhang,Y., Song,Z., Wu,R., Kong,X., Zhang,H., Li,S., Gong,X., Gong,S., Cheng,J., Yuan,F., Wu,H., Wang,S. and Yuan,Z. TITLE PRRC2B modulates oligodendrocyte progenitor cell development and myelination by stabilizing Sox2 mRNA JOURNAL Cell Rep 43 (3), 113930 (2024) PUBMED 38507412 REFERENCE 3 (bases 1 to 1912) AUTHORS Bechelli,L., Tomasella,E., Cardoso,S.L., Belmonte,M. and Gelman,D.M. TITLE Selective dopamine D2 receptor deletion from Nkx6.2 expressing cells causes impaired cognitive, motivation and anxiety phenotypes in mice JOURNAL Sci Rep 13 (1), 19473 (2023) PUBMED 37945756 REMARK GeneRIF: Selective dopamine D2 receptor deletion from Nkx6.2 expressing cells causes impaired cognitive, motivation and anxiety phenotypes in mice. Publication Status: Online-Only REFERENCE 4 (bases 1 to 1912) AUTHORS Cheffer,A., Garcia-Miralles,M., Maier,E., Akol,I., Franz,H., Srinivasan,V.S.V. and Vogel,T. TITLE DOT1L deletion impairs the development of cortical parvalbumin-expressing interneurons JOURNAL Cereb Cortex 33 (19), 10272-10285 (2023) PUBMED 37566909 REFERENCE 5 (bases 1 to 1912) AUTHORS Sans,M., Makino,Y., Min,J., Rajapakshe,K.I., Yip-Schneider,M., Schmidt,C.M., Hurd,M.W., Burks,J.K., Gomez,J.A., Thege,F.I., Fahrmann,J.F., Wolff,R.A., Kim,M.P., Guerrero,P.A. and Maitra,A. TITLE Spatial Transcriptomics of Intraductal Papillary Mucinous Neoplasms of the Pancreas Identifies NKX6-2 as a Driver of Gastric Differentiation and Indolent Biological Potential JOURNAL Cancer Discov 13 (8), 1844-1861 (2023) PUBMED 37285225 REMARK GeneRIF: Spatial Transcriptomics of Intraductal Papillary Mucinous Neoplasms of the Pancreas Identifies NKX6-2 as a Driver of Gastric Differentiation and Indolent Biological Potential. REFERENCE 6 (bases 1 to 1912) AUTHORS Awatramani,R., Beesley,J., Yang,H., Jiang,H., Cambi,F., Grinspan,J., Garbern,J. and Kamholz,J. TITLE Gtx, an oligodendrocyte-specific homeodomain protein, has repressor activity JOURNAL J Neurosci Res 61 (4), 376-387 (2000) PUBMED 10931524 REFERENCE 7 (bases 1 to 1912) AUTHORS Qiu,M., Shimamura,K., Sussel,L., Chen,S. and Rubenstein,J.L. TITLE Control of anteroposterior and dorsoventral domains of Nkx-6.1 gene expression relative to other Nkx genes during vertebrate CNS development JOURNAL Mech Dev 72 (1-2), 77-88 (1998) PUBMED 9533954 REFERENCE 8 (bases 1 to 1912) AUTHORS Awatramani,R., Scherer,S., Grinspan,J., Collarini,E., Skoff,R., O'Hagan,D., Garbern,J. and Kamholz,J. TITLE Evidence that the homeodomain protein Gtx is involved in the regulation of oligodendrocyte myelination JOURNAL J Neurosci 17 (17), 6657-6668 (1997) PUBMED 9254678 REFERENCE 9 (bases 1 to 1912) AUTHORS Lih,C.J., Cohen,S.N., Wang,C. and Lin-Chao,S. TITLE The platelet-derived growth factor alpha-receptor is encoded by a growth-arrest-specific (gas) gene JOURNAL Proc Natl Acad Sci U S A 93 (10), 4617-4622 (1996) PUBMED 8643452 REFERENCE 10 (bases 1 to 1912) AUTHORS Komuro,I., Schalling,M., Jahn,L., Bodmer,R., Jenkins,N.A., Copeland,N.G. and Izumo,S. TITLE Gtx: a novel murine homeobox-containing gene, expressed specifically in glial cells of the brain and germ cells of testis, has a transcriptional repressor activity in vitro for a serum-inducible promoter JOURNAL EMBO J 12 (4), 1387-1401 (1993) PUBMED 8096811 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from AC112670.11. On Sep 30, 2022 this sequence version replaced NR_027857.1. Transcript Variant: This variant (2) represents a longer, spliced 3' UTR. This variant is represented as non-coding because the transcript a candidate for nonsense-mediated mRNA decay (NMD). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK008173.1, SRR7345562.634674.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN00849376, SAMN00849377 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-669 AC112670.11 124850-125518 c 670-842 AC112670.11 124597-124769 c 843-1666 AC112670.11 123581-124404 c 1667-1912 AC112670.11 122092-122337 c FEATURES Location/Qualifiers source 1..1912 /organism="Mus musculus" /mol_type="transcribed RNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="7" /map="7 84.57 cM" gene 1..1912 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /note="NK6 homeobox 2" /db_xref="GeneID:14912" /db_xref="MGI:MGI:1352738" misc_RNA 1..1912 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /product="NK6 homeobox 2, transcript variant 2" /db_xref="GeneID:14912" /db_xref="MGI:MGI:1352738" exon 1..669 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /inference="alignment:Splign:2.1.0" misc_feature 264..1097 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_183248.4" /note="primary ORF has stop codon >50 nucleotides from the terminal splice site; nonsense-mediated decay (NMD) candidate" exon 670..842 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /inference="alignment:Splign:2.1.0" exon 843..1666 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /inference="alignment:Splign:2.1.0" exon 1667..1912 /gene="Nkx6-2" /gene_synonym="Gtx; Nkx6.2" /inference="alignment:Splign:2.1.0" ORIGIN
gctccgacctgccccggagccgccactgccgctcccgccgcccttagtatccctgccttctctctgaccgccgcccattcagcgcaacagccgtcggtcctctcgctttcccgtaggggccgtcggcgttcgtttgaaacgcggtccacccgtcccagcgtagccggcgctcttcggcgccgcgcgcaaacttcccgagccggcgggtgcgggcggtggcagcggggcccggatgggcgcccgggtcggaggcggcggcgcccatggacgctaaccgcccgggtgcgtttgtgctgagcagcgcgcctttagccgcgctgcacaacatggctgagatgaagacgtcgctgttcccctacgcgctgcagggcccggcgggcttcaagacacccgccctaggcagccttggcgcgcagttgcctctaggcactccgcacggcatcagcgacatcctgggacggccggtgggcgcagcgggtggcggcctcctaggaagtctgccccgtctcaacgggctcgcctcgtctgcaggtgtctacttcgggcccgcagccgccgtggctcggggctaccccaagccgctggcggaactgcctgggcgcccgcccatcttctggcctggggtggtgcagggctctccctggagggacccgcgactggccggctccgcccaagccggcggggtcctggataaggatggcaagaagaaacactcgcggccgactttctccggccagcagatcttcgcgctggagaagactttcgagcagaccaagtatttggcaggcccagagcgcgcgcggcttgcctactctctgggcatgaccgagagccaagtgaaggtgtggttccagaatcggcggaccaagtggcgcaagcggcacgcggcagagatggcgtcggctaaaaagaagcaagactcggatgccgagaagctgaaggtgggtggctcagacgcggaggacgatgacgaatacaaccggcccctggaccccaactccgatgacgagaagatcacgcggcttctcaaaaagcacaaaccctcgaacttggcgctcgttagcccgtgtggtggcagcgcgggggacgccttgtgaggacgcggccaggccggagaacccgagaaccgggactcgcggcatgccccgacgccagccgcccagccgcagtgtgtatatatatttttacagaataagttataaagcggacgttggcgcggccttggcgtgatggcggagtacggggtttgggccgatcactttgtataatcaataaattatttaacacgtcctcgtcggagccgtggctcccaaggctgcacatcgtgtttcttccatacggagctggcaccagcgggcgggcaggaccctgcagacccacctagcctgttctctctgtgggcgccagagactggcgcaggggggcgcgacagtgcttgatgacgacctggggcccgtgtgcgcctttggttcagaggttgagtgcctggtgatggtcccagagcgcacggtgatggcagcttgcaggagcgcagaggttgtgagactgagcatgccccgggtcgtgggaaggcagcttcagccgccggggaagggaaggacaccgctgcgcagtgcttggaggagctgggccagcagggaactcagcggaagagaccccaaagcaggaaccgagcagtcacttccagaggccttcacgggaaggacccacagctggaacccacggacaaccgctgcggacatggcacattggcaagcagcgaccatggcagtcacagacccgaccctggcatcaaggacacaggccggccttgagtgatttctagggaaaccgacattaactcgcgcctccgccccatccaggaactgtagtgttcagaagtaaatcaataaaagcacgctgtgtttcctca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]