LOCUS       NM_194063               1048 bp    mRNA    linear   ROD 07-AUG-2023
DEFINITION  Mus musculus reproductive homeobox 3A (Rhox3a), mRNA.
ACCESSION   NM_194063 XM_356321
VERSION     NM_194063.3
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1048)
  AUTHORS   Song HW, Bettegowda A, Oliver D, Yan W, Phan MH, de Rooij DG,
            Corbett MA and Wilkinson MF.
  TITLE     shRNA off-target effects in vivo: impaired endogenous siRNA
            expression and spermatogenic defects
  JOURNAL   PLoS One 10 (3), e0118549 (2015)
   PUBMED   25790000
  REMARK    GeneRIF: The Rhox3 shRNA causes spermatogenic defects by
            sequestering one or more components of the endogenous small RNA
            biogenesis machinery.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1048)
  AUTHORS   Hu Z, Shanker S, MacLean JA 2nd, Ackerman SL and Wilkinson MF.
  TITLE     The RHOX5 homeodomain protein mediates transcriptional repression
            of the netrin-1 receptor gene Unc5c
  JOURNAL   J Biol Chem 283 (7), 3866-3876 (2008)
   PUBMED   18077458
REFERENCE   3  (bases 1 to 1048)
  AUTHORS   MacLean,J.A. 2nd, Lorenzetti,D., Hu,Z., Salerno,W.J., Miller,J. and
            Wilkinson,M.F.
  TITLE     Rhox homeobox gene cluster: recent duplication of three family
            members
  JOURNAL   Genesis 44 (3), 122-129 (2006)
   PUBMED   16496311
REFERENCE   4  (bases 1 to 1048)
  AUTHORS   Morris L, Gordon J and Blackburn CC.
  TITLE     Identification of a tandem duplicated array in the Rhox alpha locus
            on mouse chromosome X
  JOURNAL   Mamm Genome 17 (2), 178-187 (2006)
   PUBMED   16465597
REFERENCE   5  (bases 1 to 1048)
  AUTHORS   Maclean JA 2nd, Chen MA, Wayne CM, Bruce SR, Rao M, Meistrich ML,
            Macleod C and Wilkinson MF.
  TITLE     Rhox: a new homeobox gene cluster
  JOURNAL   Cell 120 (3), 369-382 (2005)
   PUBMED   15707895
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DQ058640.1 and AL451076.14.
            
            On May 29, 2010 this sequence version replaced NM_194063.2.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: DQ058640.1 [ECO:0000332]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-868               DQ058640.1         1-868
            869-1048            AL451076.14        185349-185528
FEATURES             Location/Qualifiers
     source          1..1048
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="X"
                     /map="X 21.67 cM"
     gene            1..1048
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /note="reproductive homeobox 3A"
                     /db_xref="GeneID:382209"
                     /db_xref="MGI:MGI:2676626"
     exon            1..62
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /inference="alignment:Splign:2.1.0"
     exon            63..211
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /inference="alignment:Splign:2.1.0"
     exon            212..401
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /inference="alignment:Splign:2.1.0"
     CDS             221..868
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /note="reproductive homeobox 3; reproductive homeobox on X
                     chromosome, 3; testis expressed homeobox 2"
                     /codon_start=1
                     /product="reproductive homeobox 3A"
                     /protein_id="NP_918952.2"
                     /db_xref="CCDS:CCDS30076.1"
                     /db_xref="GeneID:382209"
                     /db_xref="MGI:MGI:2676626"
                     /translation="

MSMKPERSISNWIHSNVERAGRNLFQVNGHRSALLPELPQDYHRASRSVNGCETKMDSTQGTKVLPAEEGKNEEDGGQVESALGATAARGRGKEALNGESPAAAGTAGLVEEDRNKEDGGTKGGEKNEQEVREQIPEHVEGESDQAEAPRQVPRRRLHHRFTQWQLDELERIFRMNYFLSLEARKQLARWMGVNEAIVKRWFQKRREQYRWYKRL"

     misc_feature    683..853
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /note="Homeodomain; DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:238039"
     misc_feature    order(683..697,701..703,752..754,770..772,809..811,
                     815..820,827..832,836..844,848..853)
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:238039"
     misc_feature    order(689..691,698..700,818..820,827..832,839..841)
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:238039"
     exon            402..771
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /inference="alignment:Splign:2.1.0"
     exon            772..817
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /inference="alignment:Splign:2.1.0"
     exon            818..1048
                     /gene="Rhox3a"
                     /gene_synonym="Gm1138; Prx; Rhox3; Rhox3.1"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

gcaaatttacaagagagatgatgcaggacccaaggagaaacagcagtctcttccaaactcagggaatcaatgtggagcactagaccaagaggtagttctacaaacattttcctcaagggctccagagttactgggagatattttcttgctccccacaacttggcttctacagttgaccaccatcccctcggtaggaagaaaattcaataagcaacaggtgatgagcatgaagccagaacgttccatctctaactggatacatagtaatgtggaacgggctggaagaaatctcttccaggtcaacggtcaccgctctgctctattaccggaactacctcaggattaccacagagcttcaaggtcagtcaacggatgtgagactaaaatggacagcacccaaggtaccaaggttttgccggctgaagagggaaaaaatgaagaagatggaggacaggtggagtcggcattgggagccacagccgcaaggggtagaggaaaagaagcattaaatggagagagtcccgccgctgctggcactgcaggccttgtagaggaagacaggaacaaggaagatggtggcaccaagggaggtgagaagaatgagcaggaagtgagggagcagattcctgagcatgttgaaggagagagtgaccaggctgaagcgccaaggcaggtgccacgacgtcgattgcaccatagattcacccagtggcagctggacgaactggagagaattttccggatgaattattttctcagtctagaagcaagaaaacaactggcccgatggatgggtgtgaatgaagccatagtgaagagatggtttcagaagaggagagaacaatacaggtggtataagaggctataaggtctcagaagttctcctcctgcttctcagaacatctttcctgaagactgtggaggaaccctgcagtgccactatcgccaaggcaacatagagagaggaattgctttcgtctcctaacgatatgttattaaactcttatatctgaagcgattatatttcaataacaatatgaattttcaa

//