GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-05 06:40:59, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       NM_178657               1840 bp    mRNA    linear   ROD 04-AUG-2023
DEFINITION  Mus musculus oogenesin 1 (Oog1), mRNA.
ACCESSION   NM_178657 XM_622900
VERSION     NM_178657.5
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1840)
  AUTHORS   Honda S, Miki Y, Miyamoto Y, Kawahara Y, Tsukamoto S, Imai H and
            Minami N.
  TITLE     Oocyte-specific gene Oog1 suppresses the expression of
            spermatogenesis-specific genes in oocytes
  JOURNAL   J Reprod Dev 64 (4), 297-301 (2018)
   PUBMED   29731491
  REMARK    GeneRIF: These results indicate that Oog1 down-regulates the
            expression of spermatogenesis-associated genes in female germ
            cells, allowing them to develop normally into oocytes.
REFERENCE   2  (bases 1 to 1840)
  AUTHORS   Ishida M, Okazaki E, Tsukamoto S, Kimura K, Aizawa A, Kito S, Imai
            H and Minami N.
  TITLE     The promoter of the oocyte-specific gene, Oog1, functions in both
            male and female meiotic germ cells in transgenic mice
  JOURNAL   PLoS One 8 (7), e68686 (2013)
   PUBMED   23894331
  REMARK    GeneRIF: aberrant demethylation of the proximal promoter region
            induced ectopic expression in male germ cells under the control of
            3.9 kb Oog1 promoter
            Publication Status: Online-Only
REFERENCE   3  (bases 1 to 1840)
  AUTHORS   Monti M and Redi C.
  TITLE     Oogenesis specific genes (Nobox, Oct4, Bmp15, Gdf9, Oogenesin1 and
            Oogenesin2) are differentially expressed during natural and
            gonadotropin-induced mouse follicular development
  JOURNAL   Mol Reprod Dev 76 (10), 994-1003 (2009)
   PUBMED   19480014
  REMARK    GeneRIF: RT-PCR data shows an increase in oogenesis specific gene
            transcripts (Nobox, Oct4, Bmp15, Gdf9, Oogenesin1 and Oogenesin2)
            between the primordial until the preantral stages, with the
            exception of the Oogenesin1 transcripts under
            gonadotropin-induction.
REFERENCE   4  (bases 1 to 1840)
  AUTHORS   Evsikov AV, Graber JH, Brockman JM, Hampl A, Holbrook AE, Singh P,
            Eppig JJ, Solter D and Knowles BB.
  TITLE     Cracking the egg: molecular dynamics and evolutionary aspects of
            the transition from the fully grown oocyte to embryo
  JOURNAL   Genes Dev 20 (19), 2713-2727 (2006)
   PUBMED   17015433
REFERENCE   5  (bases 1 to 1840)
  AUTHORS   Tsukamoto S, Ihara R, Aizawa A, Kishida S, Kikuchi A, Imai H and
            Minami N.
  TITLE     Oog1, an oocyte-specific protein, interacts with Ras and
            Ras-signaling proteins during early embryogenesis
  JOURNAL   Biochem Biophys Res Commun 343 (4), 1105-1112 (2006)
   PUBMED   16580637
REFERENCE   6  (bases 1 to 1840)
  AUTHORS   Dade S, Callebaut I, Mermillod P and Monget P.
  TITLE     Identification of a new expanding family of genes characterized by
            atypical LRR domains. Localization of a cluster preferentially
            expressed in oocyte
  JOURNAL   FEBS Lett 555 (3), 533-538 (2003)
   PUBMED   14675769
REFERENCE   7  (bases 1 to 1840)
  AUTHORS   Minami N, Aizawa A, Ihara R, Miyamoto M, Ohashi A and Imai H.
  TITLE     Oogenesin is a novel mouse protein expressed in oocytes and early
            cleavage-stage embryos
  JOURNAL   Biol Reprod 69 (5), 1736-1742 (2003)
   PUBMED   12890732
REFERENCE   8  (bases 1 to 1840)
  AUTHORS   Piao Y, Ko NT, Lim MK and Ko MS.
  TITLE     Construction of long-transcript enriched cDNA libraries from
            submicrogram amounts of total RNAs by a universal PCR amplification
            method
  JOURNAL   Genome Res 11 (9), 1553-1558 (2001)
   PUBMED   11544199
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            CF915726.1, AK143386.1, AB050008.3 and DV647701.1.
            
            On Aug 1, 2012 this sequence version replaced NM_178657.4.
            
            ##Evidence-Data-START##
            RNAseq introns :: single sample supports all introns SAMN00849374
                              [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on expression, longest protein
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-23                CF915726.1         1-23
            24-547              AK143386.1         2-525
            548-1797            AB050008.3         138-1387
            1798-1840           DV647701.1         514-556
FEATURES             Location/Qualifiers
     source          1..1840
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="12"
                     /map="12 41.84 cM"
     gene            1..1840
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="oogenesin 1"
                     /db_xref="GeneID:193322"
                     /db_xref="MGI:MGI:2679150"
     exon            1..103
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /inference="alignment:Splign:2.1.0"
     CDS             74..1564
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /codon_start=1
                     /product="oogenesin-1"
                     /protein_id="NP_848772.3"
                     /db_xref="CCDS:CCDS49123.1"
                     /db_xref="GeneID:193322"
                     /db_xref="MGI:MGI:2679150"
                     /translation="
MVICLHCPDQDDSLEEVTEECYSPPTLQNLAIQSLLRDEALAISALTDLPQSLFPVIFEEAFTDGYIGILKAMIPVWPFPYLSLGKQINNCNLETLKAMLEGLDILLAQKVQTSRCKLRVINWREDDLKIWAGSHEGEGLPDFRTEKQPIENSAGCEVKKELKVTTEVLRMKGRLDESTTYLLQWAQQRKDSIHLFCRKLLIEGLTKASVIEIFKTVHADCIQELILRCICIEELAFLNPYLKLMKSLFTLTLDHIIGTFSLGDSEKLDEETIFSLISQLPTLHCLQKLYVNDVPFIKGNLKEYLRCLKKPLETLCISNCDLSQSDLDCLPYCLNICELKHLHISDIYLCDLLLEPLGFLLERVGDTLKTLELDSCCIVDFQFSALLPALSQCSHLREVTFYDNDVSLPFLKQLLHHTALLSQLIYECYPAPLECYDDSGVILTHRLESFCPELLDILRAKRQLHSVSFQTTKCSKCGGCYIYDRHTQCCRFVELL"
     misc_feature    416..490
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 1, degenerate.
                     /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    653..727
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 2, degenerate.
                     /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    728..805
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 3, degenerate.
                     /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    806..919
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 4, degenerate.
                     /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    920..997
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 5. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    998..1093
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 6. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    1094..1165
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 7. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    1166..1249
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 8. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     misc_feature    1250..1324
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
                     Region: LRR 9. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
     exon            104..414
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /inference="alignment:Splign:2.1.0"
     exon            415..990
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /inference="alignment:Splign:2.1.0"
     exon            991..1835
                     /gene="Oog1"
                     /gene_synonym="c-1; Oog"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      
gattcatagcaaggagaggaagtatagattaggtctcttggagcctggagtcacagctttcccttgcccgaatatggtgatctgtctccattgtccagatcaggatgattctttagaagaagtcacagaggaatgctattccccacccaccctccagaacctggcaattcagagtctactgagggatgaggccttggccatttctgctctcacggacctgccccagagtctgttcccagtaatttttgaggaggccttcactgatggatatatagggatcttgaaggccatgatacctgtgtggcccttcccatacctttctttaggaaagcagataaataattgcaacctggagactttgaaggctatgcttgagggactagatatactgcttgcacaaaaggttcaaaccagtaggtgcaaactcagagtaattaattggagagaagatgacttgaagatatgggctggatcccatgaaggtgaaggcttaccagatttcaggacagagaagcagccaattgagaacagtgctggctgtgaggtgaagaaagaattgaaggtgacgactgaagtccttcgcatgaagggcagacttgatgaatctaccacatacttgttgcagtgggcccagcagagaaaagattctattcatctattctgtagaaagctactaattgaaggcttaaccaaagcctcagtgatagaaatcttcaaaactgtacacgcagactgtatacaggagcttatcctaagatgtatctgcatagaagagttggcttttcttaatccctacctgaaactgatgaaaagtcttttcacactcacactagatcacatcataggtaccttcagtttgggtgattctgaaaagcttgatgaggagacaatattcagcttgatttctcaacttcccacactccactgtctccagaaactctatgtaaatgatgtcccttttataaaaggcaacctgaaagaatacctcaggtgcctgaaaaagcccttggagacactttgcatcagtaactgtgacctctcacagtcagacttggattgcctgccctattgcctgaatatttgtgaactcaaacatctgcatattagtgatatatatttatgtgatttactccttgagcctcttggttttctccttgagagagttggagataccctgaaaaccctggaattggattcatgttgtatagtggactttcagttcagtgccttgctgcctgccctaagccaatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctctagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagactggcccaatctgttgactgcatacaataaatctgttgactttttaaaaa
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]