2024-05-08 02:33:10, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_178657 1840 bp mRNA linear ROD 04-AUG-2023 DEFINITION Mus musculus oogenesin 1 (Oog1), mRNA. ACCESSION NM_178657 XM_622900 VERSION NM_178657.5 KEYWORDS RefSeq; RefSeq Select. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 1840) AUTHORS Honda S, Miki Y, Miyamoto Y, Kawahara Y, Tsukamoto S, Imai H and Minami N. TITLE Oocyte-specific gene Oog1 suppresses the expression of spermatogenesis-specific genes in oocytes JOURNAL J Reprod Dev 64 (4), 297-301 (2018) PUBMED 29731491 REMARK GeneRIF: These results indicate that Oog1 down-regulates the expression of spermatogenesis-associated genes in female germ cells, allowing them to develop normally into oocytes. REFERENCE 2 (bases 1 to 1840) AUTHORS Ishida M, Okazaki E, Tsukamoto S, Kimura K, Aizawa A, Kito S, Imai H and Minami N. TITLE The promoter of the oocyte-specific gene, Oog1, functions in both male and female meiotic germ cells in transgenic mice JOURNAL PLoS One 8 (7), e68686 (2013) PUBMED 23894331 REMARK GeneRIF: aberrant demethylation of the proximal promoter region induced ectopic expression in male germ cells under the control of 3.9 kb Oog1 promoter Publication Status: Online-Only REFERENCE 3 (bases 1 to 1840) AUTHORS Monti M and Redi C. TITLE Oogenesis specific genes (Nobox, Oct4, Bmp15, Gdf9, Oogenesin1 and Oogenesin2) are differentially expressed during natural and gonadotropin-induced mouse follicular development JOURNAL Mol Reprod Dev 76 (10), 994-1003 (2009) PUBMED 19480014 REMARK GeneRIF: RT-PCR data shows an increase in oogenesis specific gene transcripts (Nobox, Oct4, Bmp15, Gdf9, Oogenesin1 and Oogenesin2) between the primordial until the preantral stages, with the exception of the Oogenesin1 transcripts under gonadotropin-induction. REFERENCE 4 (bases 1 to 1840) AUTHORS Evsikov AV, Graber JH, Brockman JM, Hampl A, Holbrook AE, Singh P, Eppig JJ, Solter D and Knowles BB. TITLE Cracking the egg: molecular dynamics and evolutionary aspects of the transition from the fully grown oocyte to embryo JOURNAL Genes Dev 20 (19), 2713-2727 (2006) PUBMED 17015433 REFERENCE 5 (bases 1 to 1840) AUTHORS Tsukamoto S, Ihara R, Aizawa A, Kishida S, Kikuchi A, Imai H and Minami N. TITLE Oog1, an oocyte-specific protein, interacts with Ras and Ras-signaling proteins during early embryogenesis JOURNAL Biochem Biophys Res Commun 343 (4), 1105-1112 (2006) PUBMED 16580637 REFERENCE 6 (bases 1 to 1840) AUTHORS Dade S, Callebaut I, Mermillod P and Monget P. TITLE Identification of a new expanding family of genes characterized by atypical LRR domains. Localization of a cluster preferentially expressed in oocyte JOURNAL FEBS Lett 555 (3), 533-538 (2003) PUBMED 14675769 REFERENCE 7 (bases 1 to 1840) AUTHORS Minami N, Aizawa A, Ihara R, Miyamoto M, Ohashi A and Imai H. TITLE Oogenesin is a novel mouse protein expressed in oocytes and early cleavage-stage embryos JOURNAL Biol Reprod 69 (5), 1736-1742 (2003) PUBMED 12890732 REFERENCE 8 (bases 1 to 1840) AUTHORS Piao Y, Ko NT, Lim MK and Ko MS. TITLE Construction of long-transcript enriched cDNA libraries from submicrogram amounts of total RNAs by a universal PCR amplification method JOURNAL Genome Res 11 (9), 1553-1558 (2001) PUBMED 11544199 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from CF915726.1, AK143386.1, AB050008.3 and DV647701.1. On Aug 1, 2012 this sequence version replaced NM_178657.4. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMN00849374 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on expression, longest protein ##RefSeq-Attributes-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-23 CF915726.1 1-23 24-547 AK143386.1 2-525 548-1797 AB050008.3 138-1387 1798-1840 DV647701.1 514-556 FEATURES Location/Qualifiers source 1..1840 /organism="Mus musculus" /mol_type="mRNA" /strain="C57BL/6" /db_xref="taxon:10090" /chromosome="12" /map="12 41.84 cM" gene 1..1840 /gene="Oog1" /gene_synonym="c-1; Oog" /note="oogenesin 1" /db_xref="GeneID:193322" /db_xref="MGI:MGI:2679150" exon 1..103 /gene="Oog1" /gene_synonym="c-1; Oog" /inference="alignment:Splign:2.1.0" CDS 74..1564 /gene="Oog1" /gene_synonym="c-1; Oog" /codon_start=1 /product="oogenesin-1" /protein_id="NP_848772.3" /db_xref="CCDS:CCDS49123.1" /db_xref="GeneID:193322" /db_xref="MGI:MGI:2679150" /translation="
MVICLHCPDQDDSLEEVTEECYSPPTLQNLAIQSLLRDEALAISALTDLPQSLFPVIFEEAFTDGYIGILKAMIPVWPFPYLSLGKQINNCNLETLKAMLEGLDILLAQKVQTSRCKLRVINWREDDLKIWAGSHEGEGLPDFRTEKQPIENSAGCEVKKELKVTTEVLRMKGRLDESTTYLLQWAQQRKDSIHLFCRKLLIEGLTKASVIEIFKTVHADCIQELILRCICIEELAFLNPYLKLMKSLFTLTLDHIIGTFSLGDSEKLDEETIFSLISQLPTLHCLQKLYVNDVPFIKGNLKEYLRCLKKPLETLCISNCDLSQSDLDCLPYCLNICELKHLHISDIYLCDLLLEPLGFLLERVGDTLKTLELDSCCIVDFQFSALLPALSQCSHLREVTFYDNDVSLPFLKQLLHHTALLSQLIYECYPAPLECYDDSGVILTHRLESFCPELLDILRAKRQLHSVSFQTTKCSKCGGCYIYDRHTQCCRFVELL"
misc_feature 416..490 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 1, degenerate. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 653..727 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 2, degenerate. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 728..805 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 3, degenerate. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 806..919 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 4, degenerate. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 920..997 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 5. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 998..1093 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 6. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 1094..1165 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 7. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 1166..1249 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 8. /evidence=ECO:0000250|UniProtKB:Q3UWY1" misc_feature 1250..1324 /gene="Oog1" /gene_synonym="c-1; Oog" /note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1); Region: LRR 9. /evidence=ECO:0000250|UniProtKB:Q3UWY1" exon 104..414 /gene="Oog1" /gene_synonym="c-1; Oog" /inference="alignment:Splign:2.1.0" exon 415..990 /gene="Oog1" /gene_synonym="c-1; Oog" /inference="alignment:Splign:2.1.0" exon 991..1835 /gene="Oog1" /gene_synonym="c-1; Oog" /inference="alignment:Splign:2.1.0" ORIGIN
gattcatagcaaggagaggaagtatagattaggtctcttggagcctggagtcacagctttcccttgcccgaatatggtgatctgtctccattgtccagatcaggatgattctttagaagaagtcacagaggaatgctattccccacccaccctccagaacctggcaattcagagtctactgagggatgaggccttggccatttctgctctcacggacctgccccagagtctgttcccagtaatttttgaggaggccttcactgatggatatatagggatcttgaaggccatgatacctgtgtggcccttcccatacctttctttaggaaagcagataaataattgcaacctggagactttgaaggctatgcttgagggactagatatactgcttgcacaaaaggttcaaaccagtaggtgcaaactcagagtaattaattggagagaagatgacttgaagatatgggctggatcccatgaaggtgaaggcttaccagatttcaggacagagaagcagccaattgagaacagtgctggctgtgaggtgaagaaagaattgaaggtgacgactgaagtccttcgcatgaagggcagacttgatgaatctaccacatacttgttgcagtgggcccagcagagaaaagattctattcatctattctgtagaaagctactaattgaaggcttaaccaaagcctcagtgatagaaatcttcaaaactgtacacgcagactgtatacaggagcttatcctaagatgtatctgcatagaagagttggcttttcttaatccctacctgaaactgatgaaaagtcttttcacactcacactagatcacatcataggtaccttcagtttgggtgattctgaaaagcttgatgaggagacaatattcagcttgatttctcaacttcccacactccactgtctccagaaactctatgtaaatgatgtcccttttataaaaggcaacctgaaagaatacctcaggtgcctgaaaaagcccttggagacactttgcatcagtaactgtgacctctcacagtcagacttggattgcctgccctattgcctgaatatttgtgaactcaaacatctgcatattagtgatatatatttatgtgatttactccttgagcctcttggttttctccttgagagagttggagataccctgaaaaccctggaattggattcatgttgtatagtggactttcagttcagtgccttgctgcctgccctaagccaatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctctagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagactggcccaatctgttgactgcatacaataaatctgttgactttttaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]