ver.2
Home
|
Help
|
Advanced search
Previous release (v1)
2026-06-21 23:41:35, GGRNA.v2 : RefSeq release 233 (Jan, 2026)
LOCUS NM_178657 1840 bp mRNA linear ROD 23-JUN-2025
DEFINITION Mus musculus oogenesin 1 (Oog1), mRNA.
ACCESSION NM_178657 XM_622900
VERSION NM_178657.5
KEYWORDS RefSeq; RefSeq Select.
SOURCE Mus musculus (house mouse)
ORGANISM Mus musculus
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE 1 (bases 1 to 1840)
AUTHORS Honda,S., Miki,Y., Miyamoto,Y., Kawahara,Y., Tsukamoto,S., Imai,H.
and Minami,N.
TITLE Oocyte-specific gene Oog1 suppresses the expression of
spermatogenesis-specific genes in oocytes
JOURNAL J Reprod Dev 64 (4), 297-301 (2018)
PUBMED 29731491
REMARK GeneRIF: These results indicate that Oog1 down-regulates the
expression of spermatogenesis-associated genes in female germ
cells, allowing them to develop normally into oocytes.
REFERENCE 2 (bases 1 to 1840)
AUTHORS Ishida,M., Okazaki,E., Tsukamoto,S., Kimura,K., Aizawa,A., Kito,S.,
Imai,H. and Minami,N.
TITLE The promoter of the oocyte-specific gene, Oog1, functions in both
male and female meiotic germ cells in transgenic mice
JOURNAL PLoS One 8 (7), e68686 (2013)
PUBMED 23894331
REMARK GeneRIF: aberrant demethylation of the proximal promoter region
induced ectopic expression in male germ cells under the control of
3.9 kb Oog1 promoter
Publication Status: Online-Only
REFERENCE 3 (bases 1 to 1840)
AUTHORS Monti,M. and Redi,C.
TITLE Oogenesis specific genes (Nobox, Oct4, Bmp15, Gdf9, Oogenesin1 and
Oogenesin2) are differentially expressed during natural and
gonadotropin-induced mouse follicular development
JOURNAL Mol Reprod Dev 76 (10), 994-1003 (2009)
PUBMED 19480014
REMARK GeneRIF: RT-PCR data shows an increase in oogenesis specific gene
transcripts (Nobox, Oct4, Bmp15, Gdf9, Oogenesin1 and Oogenesin2)
between the primordial until the preantral stages, with the
exception of the Oogenesin1 transcripts under
gonadotropin-induction.
REFERENCE 4 (bases 1 to 1840)
AUTHORS Evsikov,A.V., Graber,J.H., Brockman,J.M., Hampl,A., Holbrook,A.E.,
Singh,P., Eppig,J.J., Solter,D. and Knowles,B.B.
TITLE Cracking the egg: molecular dynamics and evolutionary aspects of
the transition from the fully grown oocyte to embryo
JOURNAL Genes Dev 20 (19), 2713-2727 (2006)
PUBMED 17015433
REFERENCE 5 (bases 1 to 1840)
AUTHORS Tsukamoto,S., Ihara,R., Aizawa,A., Kishida,S., Kikuchi,A., Imai,H.
and Minami,N.
TITLE Oog1, an oocyte-specific protein, interacts with Ras and
Ras-signaling proteins during early embryogenesis
JOURNAL Biochem Biophys Res Commun 343 (4), 1105-1112 (2006)
PUBMED 16580637
REFERENCE 6 (bases 1 to 1840)
AUTHORS Dade,S., Callebaut,I., Mermillod,P. and Monget,P.
TITLE Identification of a new expanding family of genes characterized by
atypical LRR domains. Localization of a cluster preferentially
expressed in oocyte
JOURNAL FEBS Lett 555 (3), 533-538 (2003)
PUBMED 14675769
REFERENCE 7 (bases 1 to 1840)
AUTHORS Minami,N., Aizawa,A., Ihara,R., Miyamoto,M., Ohashi,A. and Imai,H.
TITLE Oogenesin is a novel mouse protein expressed in oocytes and early
cleavage-stage embryos
JOURNAL Biol Reprod 69 (5), 1736-1742 (2003)
PUBMED 12890732
REFERENCE 8 (bases 1 to 1840)
AUTHORS Piao,Y., Ko,N.T., Lim,M.K. and Ko,M.S.
TITLE Construction of long-transcript enriched cDNA libraries from
submicrogram amounts of total RNAs by a universal PCR amplification
method
JOURNAL Genome Res 11 (9), 1553-1558 (2001)
PUBMED 11544199
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
CF915726.1, AK143386.1, AB050008.3 and DV647701.1.
On Aug 1, 2012 this sequence version replaced NM_178657.4.
##Evidence-Data-START##
RNAseq introns :: single sample supports all introns SAMN00849374
[ECO:0000348]
##Evidence-Data-END##
##RefSeq-Attributes-START##
RefSeq Select criteria :: based on expression, longest protein
##RefSeq-Attributes-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-23 CF915726.1 1-23
24-547 AK143386.1 2-525
548-1797 AB050008.3 138-1387
1798-1840 DV647701.1 514-556
FEATURES Location/Qualifiers
source 1..1840
/organism="Mus musculus"
/mol_type="mRNA"
/strain="C57BL/6"
/db_xref="taxon:10090"
/chromosome="12"
/map="12 41.84 cM"
gene 1..1840
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="oogenesin 1"
/db_xref="GeneID:193322"
/db_xref="MGI:MGI:2679150"
exon 1..103
/gene="Oog1"
/gene_synonym="c-1; Oog"
/inference="alignment:Splign:2.1.0"
CDS 74..1564
/gene="Oog1"
/gene_synonym="c-1; Oog"
/codon_start=1
/product="oogenesin-1"
/protein_id="NP_848772.3"
/db_xref="CCDS:CCDS49123.1"
/db_xref="GeneID:193322"
/db_xref="MGI:MGI:2679150"
/translation="
MVICLHCPDQDDSLEEVTEECYSPPTLQNLAIQSLLRDEALAISALTDLPQSLFPVIFEEAFTDGYIGILKAMIPVWPFPYLSLGKQINNCNLETLKAMLEGLDILLAQKVQTSRCKLRVINWREDDLKIWAGSHEGEGLPDFRTEKQPIENSAGCEVKKELKVTTEVLRMKGRLDESTTYLLQWAQQRKDSIHLFCRKLLIEGLTKASVIEIFKTVHADCIQELILRCICIEELAFLNPYLKLMKSLFTLTLDHIIGTFSLGDSEKLDEETIFSLISQLPTLHCLQKLYVNDVPFIKGNLKEYLRCLKKPLETLCISNCDLSQSDLDCLPYCLNICELKHLHISDIYLCDLLLEPLGFLLERVGDTLKTLELDSCCIVDFQFSALLPALSQCSHLREVTFYDNDVSLPFLKQLLHHTALLSQLIYECYPAPLECYDDSGVILTHRLESFCPELLDILRAKRQLHSVSFQTTKCSKCGGCYIYDRHTQCCRFVELL"
misc_feature 416..490
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 1, degenerate.
/evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 653..727
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 2, degenerate.
/evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 728..805
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 3, degenerate.
/evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 806..919
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 4, degenerate.
/evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 920..997
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 5. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 998..1093
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 6. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 1094..1165
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 7. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 1166..1249
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 8. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
misc_feature 1250..1324
/gene="Oog1"
/gene_synonym="c-1; Oog"
/note="propagated from UniProtKB/Swiss-Prot (E9Q5G7.1);
Region: LRR 9. /evidence=ECO:0000250|UniProtKB:Q3UWY1"
exon 104..414
/gene="Oog1"
/gene_synonym="c-1; Oog"
/inference="alignment:Splign:2.1.0"
exon 415..990
/gene="Oog1"
/gene_synonym="c-1; Oog"
/inference="alignment:Splign:2.1.0"
exon 991..1835
/gene="Oog1"
/gene_synonym="c-1; Oog"
/inference="alignment:Splign:2.1.0"
ORIGIN
gattcatagcaaggagaggaagtatagattaggtctcttggagcctggagtcacagctttcccttgcccgaatatggtgatctgtctccattgtccagatcaggatgattctttagaagaagtcacagaggaatgctattccccacccaccctccagaacctggcaattcagagtctactgagggatgaggccttggccatttctgctctcacggacctgccccagagtctgttcccagtaatttttgaggaggccttcactgatggatatatagggatcttgaaggccatgatacctgtgtggcccttcccatacctttctttaggaaagcagataaataattgcaacctggagactttgaaggctatgcttgagggactagatatactgcttgcacaaaaggttcaaaccagtaggtgcaaactcagagtaattaattggagagaagatgacttgaagatatgggctggatcccatgaaggtgaaggcttaccagatttcaggacagagaagcagccaattgagaacagtgctggctgtgaggtgaagaaagaattgaaggtgacgactgaagtccttcgcatgaagggcagacttgatgaatctaccacatacttgttgcagtgggcccagcagagaaaagattctattcatctattctgtagaaagctactaattgaaggcttaaccaaagcctcagtgatagaaatcttcaaaactgtacacgcagactgtatacaggagcttatcctaagatgtatctgcatagaagagttggcttttcttaatccctacctgaaactgatgaaaagtcttttcacactcacactagatcacatcataggtaccttcagtttgggtgattctgaaaagcttgatgaggagacaatattcagcttgatttctcaacttcccacactccactgtctccagaaactctatgtaaatgatgtcccttttataaaaggcaacctgaaagaatacctcaggtgcctgaaaaagcccttggagacactttgcatcagtaactgtgacctctcacagtcagacttggattgcctgccctattgcctgaatatttgtgaactcaaacatctgcatattagtgatatatatttatgtgatttactccttgagcctcttggttttctccttgagagagttggagataccctgaaaaccctggaattggattcatgttgtatagtggactttcagttcagtgccttgctgcctgccctaagccaatgttctcacctcagagaggtcactttctatgataatgatgtttctctgcctttcttgaaacaacttctacaccacacagccctgctgagtcagctgatctatgagtgttaccctgcccctctagagtgctatgatgacagtggtgtaatactaacacacagattagaaagtttttgtcctgagcttctggatatactgagagccaaaagacagctccatagtgtctcctttcaaacaaccaaatgctctaaatgtggtgggtgctacatttatgatcggcatacccaatgttgccgttttgtggaactactataagcttgattgtgaaactgagaaatagaaacttagtattggggactgatgaaatcctaagtgaatgtccactgctaaatggagcatgaaaatgtcaatcacctaaaagtctgagatacacaggaaagtcaataacttcctctgagctggtgaatggatgttgcatctgtagaaagtatcaagcacttgtagtttgaatgtgttacaatagaagcaccattttatgagactggcccaatctgttgactgcatacaataaatctgttgactttttaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]