LOCUS       NM_053212                918 bp    mRNA    linear   ROD 22-DEC-2022
DEFINITION  Mus musculus taste receptor, type 2, member 116 (Tas2r116), mRNA.
ACCESSION   NM_053212
VERSION     NM_053212.1
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 918)
  AUTHORS   Kim D, Pauer SH, Yong HM, An SS and Liggett SB.
  TITLE     beta2-Adrenergic Receptors Chaperone Trapped Bitter Taste Receptor
            14 to the Cell Surface as a Heterodimer and Exert Unidirectional
            Desensitization of Taste Receptor Function
  JOURNAL   J Biol Chem 291 (34), 17616-17628 (2016)
   PUBMED   27342779
  REMARK    GeneRIF: Thus the beta2AR acts as a double-edged sword: increasing
            TAS2R14 cell surface expression, but when activated by
            beta-agonist, partially offsetting the expression phenotype by
            direct receptor:receptor desensitization of TAS2R14 function.
REFERENCE   2  (bases 1 to 918)
  AUTHORS   Nelson TM, Munger SD and Boughter JD Jr.
  TITLE     Haplotypes at the Tas2r locus on distal chromosome 6 vary with
            quinine taste sensitivity in inbred mice
  JOURNAL   BMC Genet 6, 32 (2005)
   PUBMED   15938754
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 918)
  AUTHORS   Conte C, Ebeling M, Marcuz A, Nef P and Andres-Barquin PJ.
  TITLE     Evolutionary relationships of the Tas2r receptor gene families in
            mouse and human
  JOURNAL   Physiol Genomics 14 (1), 73-82 (2003)
   PUBMED   12734386
  REMARK    Publication Status: Online-Only
REFERENCE   4  (bases 1 to 918)
  AUTHORS   Shi P, Zhang J, Yang H and Zhang YP.
  TITLE     Adaptive diversification of bitter taste receptor genes in
            Mammalian evolution
  JOURNAL   Mol Biol Evol 20 (5), 805-814 (2003)
   PUBMED   12679530
REFERENCE   5  (bases 1 to 918)
  AUTHORS   Matsunami H, Montmayeur JP and Buck LB.
  TITLE     A family of candidate taste receptors in human and mouse
  JOURNAL   Nature 404 (6778), 601-604 (2000)
   PUBMED   10766242
REFERENCE   6  (bases 1 to 918)
  AUTHORS   Adler E, Hoon MA, Mueller KL, Chandrashekar J, Ryba NJ and Zuker
            CS.
  TITLE     A novel family of mammalian taste receptors
  JOURNAL   Cell 100 (6), 693-702 (2000)
   PUBMED   10761934
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from BK001084.1.
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
FEATURES             Location/Qualifiers
     source          1..918
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /db_xref="taxon:10090"
                     /chromosome="6"
                     /map="6 64.03 cM"
     gene            1..918
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="taste receptor, type 2, member 116"
                     /db_xref="GeneID:112408"
                     /db_xref="MGI:MGI:1890258"
     CDS             1..918
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="candidate taste receptor mt2r56; T2R116; taste
                     receptor, type 2, member 7; taste receptor, type 2, member
                     14"
                     /codon_start=1
                     /product="taste receptor type 2 member 116"
                     /protein_id="NP_444442.1"
                     /db_xref="CCDS:CCDS20625.1"
                     /db_xref="GeneID:112408"
                     /db_xref="MGI:MGI:1890258"
                     /translation="

MNGVLQVTFIVILSVEFIIGIFGNGFIAVVNIKDLVKGRKISSVDQILTALAISRIALLWLILVSWWIFVLYPGQWMTDRRVSIMHSIWTTFNQSSLWFATSLSIFYFFKIANFSNPIFLYLKVRLKKVMIGTLIMSLILFCLNIIIMNAPENILITEYNVSMSYSLILNNTQLSMLFPFANTMFGFIPFAVSLVTFVLLVFSLWKHQRKMQHSAHGCRDASTKAHIRALQTLIASLLLYSIFFLSHVMKVWSALLLERTLLLLITQVARTAFPSVHSWVLILGNAKMRKASLYVFLWLRCRHKE"

     misc_feature    22..888
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="mammalian taste receptor 2, subtype 14, member of
                     the seven-transmembrane G protein-coupled receptor
                     superfamily; Region: 7tm_TAS2R14-like; cd15019"
                     /db_xref="CDD:320147"
     misc_feature    22..99
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 1 [structural motif]; Region: TM helix 1"
                     /db_xref="CDD:320147"
     misc_feature    25..87
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     misc_feature    133..207
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 2 [structural motif]; Region: TM helix 2"
                     /db_xref="CDD:320147"
     misc_feature    166..228
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     misc_feature    247..315
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 3 [structural motif]; Region: TM helix 3"
                     /db_xref="CDD:320147"
     misc_feature    277..279
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q7M713.1); glycosylation site"
     misc_feature    304..366
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     misc_feature    385..447
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     misc_feature    394..444
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 4 [structural motif]; Region: TM helix 4"
                     /db_xref="CDD:320147"
     misc_feature    478..480
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q7M713.1); glycosylation site"
     misc_feature    508..510
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="N-linked (GlcNAc...) asparagine.
                     /evidence=ECO:0000255; propagated from
                     UniProtKB/Swiss-Prot (Q7M713.1); glycosylation site"
     misc_feature    523..594
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 5 [structural motif]; Region: TM helix 5"
                     /db_xref="CDD:320147"
     misc_feature    553..615
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     misc_feature    667..744
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 6 [structural motif]; Region: TM helix 6"
                     /db_xref="CDD:320147"
     misc_feature    709..771
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     misc_feature    778..855
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="TM helix 7 [structural motif]; Region: TM helix 7"
                     /db_xref="CDD:320147"
     misc_feature    784..846
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /note="propagated from UniProtKB/Swiss-Prot (Q7M713.1);
                     transmembrane region"
     exon            1..918
                     /gene="Tas2r116"
                     /gene_synonym="mGR16; mt2r56; T2R16; Tas2r14; Tas2r16;
                     Tas2r7; TRB1; TRB4"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atgaatggtgtcctacaggttacatttatagtcattttgagtgtggaatttataattggcatctttggcaatggattcatagcggtggtgaacataaaggacttggtcaagggaaggaagatctcttcagtggatcagatcctcactgctctggccatctccagaattgcactgctgtggttaatattagtaagttggtggatatttgtgctttacccaggacaatggatgactgatagaagagttagcataatgcacagtatatggacaacattcaaccagagtagtctctggtttgctacaagtctcagcatcttttattttttcaagatagcaaatttttccaaccctatttttctttatttaaaggtcagacttaaaaaagtcatgatagggacattgataatgtctttgattctcttttgtttaaatattatcattatgaatgcacctgagaacattttaatcactgaatataatgtatctatgtcttacagcttgattttgaataacacacagctttctatgctgtttccatttgccaacaccatgtttgggttcataccttttgctgtgtcactggtcacttttgtccttcttgttttctccctgtggaaacatcagagaaagatgcaacacagtgcccatggatgcagagatgccagcactaaggcccacatcagagccttgcagacattgattgcctccctcctcctgtattccattttcttcctgtctcatgttatgaaggtttggagtgctctgcttctggagaggacactcctgcttttgatcacacaggttgcaagaacagcttttccgtcagtgcactcctgggtcctgattctgggcaatgctaagatgagaaaggcttctctctatgtattcctgtggctgaggtgcaggcacaaagaatga

//