LOCUS       NM_011701               1834 bp    mRNA    linear   ROD 02-JAN-2024
DEFINITION  Mus musculus vimentin (Vim), mRNA.
ACCESSION   NM_011701
VERSION     NM_011701.4
KEYWORDS    RefSeq; RefSeq Select.
SOURCE      Mus musculus (house mouse)
  ORGANISM  Mus musculus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Mus; Mus.
REFERENCE   1  (bases 1 to 1834)
  AUTHORS   Lettieri A, Oleari R, van den Munkhof MH, van Battum EY, Verhagen
            MG, Tacconi C, Spreafico M, Paganoni AJJ, Azzarelli R, Andre' V,
            Amoruso F, Palazzolo L, Eberini I, Dunkel L, Howard SR, Fantin A,
            Pasterkamp RJ and Cariboni A.
  TITLE     SEMA6A drives GnRH neuron-dependent puberty onset by tuning median
            eminence vascular permeability
  JOURNAL   Nat Commun 14 (1), 8097 (2023)
   PUBMED   38062045
  REMARK    Publication Status: Online-Only
REFERENCE   2  (bases 1 to 1834)
  AUTHORS   Parvanian S, Coelho-Rato LS, Patteson AE and Eriksson JE.
  TITLE     Vimentin takes a hike - Emerging roles of extracellular vimentin in
            cancer and wound healing
  JOURNAL   Curr Opin Cell Biol 85, 102246 (2023)
   PUBMED   37783033
  REMARK    GeneRIF: Vimentin takes a hike - Emerging roles of extracellular
            vimentin in cancer and wound healing.
            Review article
REFERENCE   3  (bases 1 to 1834)
  AUTHORS   Chen X, Song QL, Wang JY, Ji R, Cao ML, Guo DY, Zhang Y and Yang J.
  TITLE     FKBP5 regulates trophoblast-macrophage crosstalk in recurrent
            spontaneous abortion through PI3K/AKT and NF-kappaB signaling
            pathways
  JOURNAL   Free Radic Biol Med 209 (Pt 1), 55-69 (2023)
   PUBMED   37827456
REFERENCE   4  (bases 1 to 1834)
  AUTHORS   Honeycutt SE, N'Guetta PY, Hardesty DM, Xiong Y, Cooper SL,
            Stevenson MJ and O'Brien LL.
  TITLE     Netrin 1 directs vascular patterning and maturity in the developing
            kidney
  JOURNAL   Development 150 (22) (2023)
   PUBMED   37818607
REFERENCE   5  (bases 1 to 1834)
  AUTHORS   Bai Y, Bentley L, Ma C, Naveenan N, Cleak J, Wu Y, Simon MM,
            Westerberg H, Canas RC, Horner N, Pandey R, Paphiti K, Schulze U,
            Mianne J, Hough T, Teboul L, de Baaij JHF and Cox RD.
  TITLE     Cleft palate and minor metabolic disturbances in a mouse global
            Arl15 gene knockout
  JOURNAL   FASEB J 37 (11), e23211 (2023)
   PUBMED   37773757
REFERENCE   6  (bases 1 to 1834)
  AUTHORS   Salier JP, Simon D, Rouet P, Raguenez G, Muscatelli F, Gebhard W,
            Guenet JL and Mattei MG.
  TITLE     Homologous chromosomal locations of the four genes for
            inter-alpha-inhibitor and pre-alpha-inhibitor family in human and
            mouse: assignment of the ancestral gene for the lipocalin
            superfamily
  JOURNAL   Genomics 14 (1), 83-88 (1992)
   PUBMED   1385302
REFERENCE   7  (bases 1 to 1834)
  AUTHORS   Pilz A, Moseley H, Peters J and Abbott C.
  TITLE     Comparative mapping of mouse chromosome 2 and human chromosome 9q:
            the genes for gelsolin and dopamine beta-hydroxylase map to mouse
            chromosome 2
  JOURNAL   Genomics 12 (4), 715-719 (1992)
   PUBMED   1315305
REFERENCE   8  (bases 1 to 1834)
  AUTHORS   Porteus MH, Brice AE, Bulfone A, Usdin TB, Ciaranello RD and
            Rubenstein JL.
  TITLE     Isolation and characterization of a library of cDNA clones that are
            preferentially expressed in the embryonic telencephalon
  JOURNAL   Brain Res Mol Brain Res 12 (1-3), 7-22 (1992)
   PUBMED   1372074
REFERENCE   9  (bases 1 to 1834)
  AUTHORS   Bastian H, Gruss P, Duboule D and Izpisua-Belmonte JC.
  TITLE     The murine even-skipped-like gene Evx-2 is closely linked to the
            Hox-4 complex, but is transcribed in the opposite direction
  JOURNAL   Mamm Genome 3 (4), 241-243 (1992)
   PUBMED   1611218
REFERENCE   10 (bases 1 to 1834)
  AUTHORS   Threadgill DS and Womack JE.
  TITLE     Mapping HSA10 homologous loci in cattle
  JOURNAL   Cytogenet Cell Genet 57 (2-3), 123-126 (1991)
   PUBMED   1655359
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK133726.1.
            
            On Apr 23, 2009 this sequence version replaced NM_011701.3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK133726.1, AK153019.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN00849374, SAMN00849375
                                           [ECO:0000348]
            ##Evidence-Data-END##
            
            ##RefSeq-Attributes-START##
            RefSeq Select criteria :: based on single protein-coding transcript
            ##RefSeq-Attributes-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1834              AK133726.1         2-1835
FEATURES             Location/Qualifiers
     source          1..1834
                     /organism="Mus musculus"
                     /mol_type="mRNA"
                     /strain="C57BL/6"
                     /db_xref="taxon:10090"
                     /chromosome="2"
                     /map="2 10.04 cM"
     gene            1..1834
                     /gene="Vim"
                     /note="vimentin"
                     /db_xref="GeneID:22352"
                     /db_xref="MGI:MGI:98932"
     exon            1..684
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     CDS             122..1522
                     /gene="Vim"
                     /codon_start=1
                     /product="vimentin"
                     /protein_id="NP_035831.2"
                     /db_xref="CCDS:CCDS15696.1"
                     /db_xref="GeneID:22352"
                     /db_xref="MGI:MGI:98932"
                     /translation="

MSTRSVSSSSYRRMFGGSGTSSRPSSNRSYVTTSTRTYSLGSALRPSTSRSLYSSSPGGAYVTRSSAVRLRSSVPGVRLLQDSVDFSLADAINTEFKNTRTNEKVELQELNDRFANYIDKVRFLEQQNKILLAELEQLKGQGKSRLGDLYEEEMRELRRQVDQLTNDKARVEVERDNLAEDIMRLREKLQEEMLQREEAESTLQSFRQDVDNASLARLDLERKVESLQEEIAFLKKLHDEEIQELQAQIQEQHVQIDVDVSKPDLTAALRDVRQQYESVAAKNLQEAEEWYKSKFADLSEAANRNNDALRQAKQESNEYRRQVQSLTCEVDALKGTNESLERQMREMEENFALEAANYQDTIGRLQDEIQNMKEEMARHLREYQDLLNVKMALDIEIATYRKLLEGEESRISLPLPTFSSLNLRETNLESLPLVDTHSKRTLLIKTVETRDGQVINETSQHHDDLE"

     misc_feature    122..220
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite"
     misc_feature    125..406
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Head"
     misc_feature    125..127
                     /gene="Vim"
                     /note="N-acetylserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    134..136
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    140..142
                     /gene="Vim"
                     /note="O-linked (GlcNAc) serine, alternate.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); glycosylation site"
     misc_feature    140..142
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC, alternate.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    143..145
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    146..148
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    149..151
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    161..424
                     /gene="Vim"
                     /note="Intermediate filament head (DNA binding) region;
                     Region: Filament_head; pfam04732"
                     /db_xref="CDD:428095"
     misc_feature    179..181
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    182..184
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    194..196
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    197..199
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    218..220
                     /gene="Vim"
                     /note="O-linked (GlcNAc) threonine. /evidence=ECO:0000250;
                     propagated from UniProtKB/Swiss-Prot (P20152.3);
                     glycosylation site"
     misc_feature    221..223
                     /gene="Vim"
                     /note="O-linked (GlcNAc) serine, alternate.
                     /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); glycosylation site"
     misc_feature    221..223
                     /gene="Vim"
                     /note="Phosphoserine, by PKC, alternate.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    236..238
                     /gene="Vim"
                     /note="Phosphoserine, by CaMK2, PKA, PKC and ROCK2.
                     /evidence=ECO:0000269|PubMed:1850997,
                     ECO:0000269|PubMed:2500966, ECO:0000269|PubMed:9565595,
                     ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    245..247
                     /gene="Vim"
                     /note="Phosphoserine, by PKC.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    260..262
                     /gene="Vim"
                     /note="Phosphoserine, by PKA.
                     /evidence=ECO:0000269|PubMed:2500966; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    266..268
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    272..274
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000269|PubMed:2500966,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    278..280
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:17947660; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    284..286
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P31000; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    287..289
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:17242355,
                     ECO:0007744|PubMed:19131326, ECO:0007744|PubMed:19144319,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    302..304
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0007744|PubMed:17947660; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    317..319
                     /gene="Vim"
                     /note="Phosphoserine, by PKA and PKC.
                     /evidence=ECO:0000269|PubMed:2500966,
                     ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    335..337
                     /gene="Vim"
                     /note="Phosphoserine, by AURKB and ROCK2.
                     /evidence=ECO:0000269|PubMed:9565595; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    338..340
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    368..370
                     /gene="Vim"
                     /note="Phosphoserine, by CaMK2.
                     /evidence=ECO:0000269|PubMed:1850997,
                     ECO:0007744|PubMed:15345747, ECO:0007744|PubMed:21183079;
                     propagated from UniProtKB/Swiss-Prot (P20152.3);
                     phosphorylation site"
     misc_feature    380..382
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    407..514
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Coil 1A"
     misc_feature    425..1351
                     /gene="Vim"
                     /note="Intermediate filament protein; Region: Filament;
                     pfam00038"
                     /db_xref="CDD:425436"
     misc_feature    470..472
                     /gene="Vim"
                     /note="Phosphotyrosine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    479..481
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    506..508
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    515..580
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Linker 1"
     misc_feature    536..538
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    551..553
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    581..856
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Coil 1B"
     misc_feature    623..625
                     /gene="Vim"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    683..685
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    761..763
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19144319; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    788..790
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    797..799
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    824..826
                     /gene="Vim"
                     /note="N6-acetyllysine.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    857..925
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Linker 12"
     misc_feature    926..1342
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Coil 2"
     misc_feature    1001..1003
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    1016..1018
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1094..1096
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1097..1108
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: [IL]-x-C-x-x-[DE] motif.
                     /evidence=ECO:0000250|UniProtKB:P08670"
     misc_feature    1172..1174
                     /gene="Vim"
                     /note="Stutter. /evidence=ECO:0000250; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); other site"
     misc_feature    1238..1240
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0007744|PubMed:23806337; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    1343..1519
                     /gene="Vim"
                     /note="propagated from UniProtKB/Swiss-Prot (P20152.3);
                     Region: Tail"
     misc_feature    1346..1348
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1355..1357
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P84198; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1376..1378
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1379..1381
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19131326,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1397..1399
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1409..1411
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19131326; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1427..1429
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1433..1435
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1454..1456
                     /gene="Vim"
                     /note="N6-acetyllysine, alternate.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); acetylation site"
     misc_feature    1457..1459
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1493..1495
                     /gene="Vim"
                     /note="Phosphothreonine.
                     /evidence=ECO:0000250|UniProtKB:P08670; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     misc_feature    1496..1498
                     /gene="Vim"
                     /note="Phosphoserine.
                     /evidence=ECO:0007744|PubMed:19144319,
                     ECO:0007744|PubMed:21183079; propagated from
                     UniProtKB/Swiss-Prot (P20152.3); phosphorylation site"
     exon            685..745
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            746..841
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            842..1003
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1004..1129
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1130..1350
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1351..1394
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1395..1480
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     exon            1481..1834
                     /gene="Vim"
                     /inference="alignment:Splign:2.1.0"
     polyA_site      1834
                     /gene="Vim"
                     /note="putative"
ORIGIN      

ctctgccactcttgctccgggaccccagagaccccagcgctcctacgattcacagccaccgcgccctcattcccttgttgcagtttttccagccgcagcaagccagcccaccttcgaagccatgtctaccaggtctgtgtcctcgtcctcctaccgcaggatgttcggtggctccggcacatcgagccggcccagctccaaccggagctatgtgaccacgtccacacgcacctacagtctgggcagcgcactgcgccccagcactagccgcagcctctattcctcatcccccggtggcgcctatgtgacccggtcctcggcagtgcgcctgcggagcagcgtgccgggcgtgcggctgcttcaagactcggtggacttctcgctggccgacgccatcaacactgagttcaagaacacccgcaccaacgagaaggtagaactgcaggagctgaatgaccgctttgccaactacatcgacaaggtgcgcttcctcgagcagcagaacaaaatcctgctggctgagctcgagcagctcaagggccagggcaagtcgcgcctgggcgacctgtacgaggaggagatgcgggagctgcgccggcaggtggatcagctcaccaacgacaaggcccgtgtcgaggtggagcgggacaacctggccgaggacatcatgcggctgcgagagaaattgcaggaggagatgctccagagagaggaagccgaaagcaccctgcagtcattcagacaggatgttgacaatgcttctctggcacgtcttgaccttgaacggaaagtggaatccttgcaggaagaaattgcctttttgaagaaactgcacgatgaagagatccaggagctgcaggcccagattcaggaacagcatgtccagatcgatgtggacgtttccaagcctgacctcactgctgccctgcgtgatgtgcgccagcagtatgaaagcgtggctgccaagaacctccaggaggccgaggaatggtacaagtccaagtttgctgacctctctgaggctgccaaccggaacaacgatgccctgcgccaggccaagcaggagtcaaacgagtaccggagacaggtgcagtcactcacctgtgaagtggatgcccttaaaggcactaacgagtccctggagcgccagatgcgtgagatggaagagaattttgcccttgaagctgctaactaccaggacactattggccgcctgcaggatgagatccaaaacatgaaggaagagatggctcgtcaccttcgtgaataccaagatctgctcaatgttaagatggccctggacattgagatcgccacctacaggaagctgctggaaggcgaggagagcaggatttctctgcctctgccaaccttttcttccctgaacctgagagaaactaacctggagtcacttcctctggttgacacccactcaaaaagaacactcctgattaagacggttgagaccagagatggacaggtgatcaatgagacttctcagcatcacgatgaccttgaataaaaattgcacacacttggtgcaacagtgcagtaccagcaagaaggaaaaaaaaatcgtatcttaggaaaacagctttcaagtgcctttactgcagtttttcaggagcgcaagatagatttggaatagaaagaagctcagcacttaacaactgacaccccaaaagacgtagaaaaggtttacaaaataatctagtttacgaagaaatcttgtgctagaatactttttaaagtatttttgaataccattaaaactgcttttttccagtaaatatctgaccaacttgttactgcttcaataaatcttcaaaaatac

//